--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12384 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        837        938   0   Terminal    102    80        Good
cgcaggcctactgagccgcggcgaagtccaggcgttgtctgaaggccgcggtgtgccctc
gtcgcgccctgggctggcgggccaatatgagcggcaggcccagagagcgcaggtgggggc
gaccctcaggtcacgccagggtcatggcccgctctgacccctgctctgcccctgccctag
GAAGATGTTAGCTCAGAGGCACAGAGCTACGCCTTCGAAGCGCGCAGCGCCGGCCAAGGG
GAAGGAAAGGGGAGCCTGGAGAAAATCGCAGGGAAGAACTAG
agggagccgggcccagaagctcagggcgaggccgaggcggctgaggctgctttagctcct
gctccgggctggagctgccagggctgccgccgccgcctccttcaggcgggcgcaggcgag
cgggcgggcggagtgggggactctccgggcgctgacatttgcaggctgccctcctgattg

Exon  2 +       1349       1385   0    Initial     37    82        Good
cgtctctctaaaggacattataatgcaagaagccccctttttaaccacaaaccgaatttt
ctttcatttaggtgatctatatatatctatatcgtatagcttatagcttatatctatttt
aaataacttaaagccgctaaaatttgggggggaacagctttcgccctggagcggtgcgcg
ATGCTGTCTCATGCCGACCTCCTGGACGCCAGGCTAG
gtgagtgcgcgcctctcgcccgggcagccaggagaagccggggcaggaaattgtcaattt
gttccttattttaccttaatgcgacctaaatggactaatttctttaaaagtaattgtgct
gcattaaagtttaatttgatttaacatcgcctttaaaaaaaaatctatggaatatgtaga

Exon  3 +       2668       3077   1   Internal    410    78        Good
tattccaacccggctgtccaaattctggggaacccagctgaataccctgggagtttcttc
cttaggacaagcgcgggtgcggagggggccgaggacgggttgaaggaaggctgcgcgggg
aagacagcccctcctggcatcgccaagaaagtagtgaccgcgatccccttgcctcctcag
GTATGAAAGATGCCGCCGAGCTTCTGGGCCACCGGGAGGCGGTGAAGTGTAGGCTGGGCG
TGGGGGGCTCCGACCCCGGGGGCCATCCGGGGGACCTGGCGCCCAACTCTGACCCAGTGG
AGGGAGCCACTCTGCTGCCCGGGGAGGACATCACCACAGTGGGCTCTACTCCGGCCTCGC
TGGCGGTGAGCGCCAAAGACCCGGACAAGCAGCCCGGGCCCCAGGGCGGCCCGAACCCCA
GCCAAGCCGGCCAGCAGCAGGGCCAACAGAAGCAGAAGCGCCACCGGACGCGCTTCACCC
CCGCACAGCTCAACGAGTTGGAGAGGAGCTTCGCCAAGACTCACTACCCCGACATCTTTA
TGCGTGAGGAGCTGGCACTGCGTATCGGGCTGACCGAGTCCCGAGTGCAG
gtacgaggggcttgggatctgggacagaaggcaaggacagggcgggaggatttgggcaaa
gggagcagggtcttcccttcccctgtcgagatcctgggctgctttcaggctgcctgtgcg
ttcctgtatcgagttatctccttctctacccggaaactggtccccatcgccatcccccaa

Exon  4 +       7108       7374   2   Internal    267    50    Marginal
cccgagtccagccttgggtgggtgctgcacagcgactttcggccttaggtcttctcgctg
tgccttcctttcctcctgagagatgctctccgcctaagaccgctaacagctcaattgggt
ctcattgatcccactcaccatctagagccctgttgcctcattaatccgttgtgccaccag
CTCACGGGCTGCAACTGGGAAGAGACGAGACCTGTTTATCCATCGCCGACACTGGGATAC
GCAGCAATCTGCAAAATGGGGTAGAAACCACAGGAAGAAAGTGGTAGGCGACGGCGCAGG
CACGGTAGAAAGGCGAGGGCCGGCCCCAAGCTGGGGGAGTATTCTAGACTGCAACACCGT
TCACACTGGTAAGCGTAGAGTGCGTCTACGCTTGCCTGGGCATGAACACACCGCTGAACA
TTGCTGGCTCACCGAGACCGAGGGCAG
gtatgtccatacccctgatactttagcttgcagagtaaacactaaataggttagattaac
ggatgcacaacgtttttttccacggatatcgtggtcaaattgcgttggccaaattctaag
aggaaactcagtacctgggcttgtcctacatcatttatatttaggcacagtaaacgccag

Exon  5 +       9104       9484   0   Internal    381    72        Good
ggagttggtggggagccacagtctccggctgggtatgggggcttgtcgggcctacggcac
ttgttcctcccagggcagagcggctgtatccgaggcgggtttctggggctcaagccccaa
ctccccagccgccgggccggctaatagctccctgtctgtctcccgccccgcccgctccag
GTCTGGTTCCAGAACCGACGCGCCAAGTGGAAGAAGCGCAAAAAGACGACCAACGTGTTC
CGTGCGCCCGGCACACTGCTGCCCACGCCAGGCCTGCCTCAGTTCCCGTCGGCTGCCGCC
GCCGCTGCCGCCGCCATGGGCGACAGCCTGTGCTCTTTCCACGCCAACGACACCCGCTGG
GCGGCGGCCGCCATGCCTGGCGTGTCACAGCTGCCTCTGCCGCCGGCGCTGGGCAGGCAG
CAGGCCATGGCGCAGTCGCTGTCCCAGTGCAGCCTGGCGGCCGGTCCGCCGCCCAACTCC
ATGGGCCTGTCCAACAGCCTGGCGGGTTCCAACGGCGCGGGGCTGCAGTCGCACCTCTAC
CAGCCCGCCTTCCCCGGCATG
gtgcccgcctccctccccggccccagcaacgtctccggttcgccccagctctgcagctcc
ccggacagcagcgacgtgtggcggggcaccagcatcgcctccctccgccgcaaggcgcta
gagcacacagtctctatgagcttcacttaatgcagccgcgccccggcccgctccgccccc

Exon  6 +      10736      10984   0   Terminal    249    53    Marginal
cttctcaggaggaacgtgacagtggattgggtggctggagtagactaaagcagtcatgtg
acgaggaagaggtgatctgacccattttgataagtctttataaggaagaataaaataaac
gtgtaagcaaaattttcttttgtaaaagcaaaagccacatctcttttctggatccttcag
GACTGGGGTTTGTTTGCTTCCTTTTCTGTTTCTGTCTTCTCGCTGCTCTGTGCCCTTGGT
TGTTTTGTGGTGGTCCTGTCGTCCCTCGTGCCCCTCGGCCACCTGCTGGCAGCCGATGGG
GGCACTCGGACATCTACAACCCTGCAACTTTGTACAGAGAAACACAATCAGCTCTTTCTG
CATGTGCTGGTCAAATCCAAACCCAGAGAACAGAAGCGCTTTCTAAGAATGAACAAATAT
GTGAAATAG
gatgttttgtgtagataaagcattcttgttacatactggtcaatttgtgatatgttttaa
cttaatgtctgtgtttatttatggaattcggttttcttaataaatgtttgagctaatata
aagcatattatttgacttttccggacaagtttatatcaagttaaatgtaaatggataaaa

--------------------------------------------------------------------------------