--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (165258 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      11222      11305   0    Initial     84    65    Marginal
tgttttagatgctaacttacctccttacacttgagaaactgatgtggttcatcacagccc
aatgccatgtcttgaaacaactgcggacactgatcttgaaatagccagggctataggatc
atgtctttgtaaagaacaacagcagctttagagtcactggatggtatattcgttgcaaac
ATGAACAGCTTCATGAACTCCCAGGAAGTGGTACAGTTATTGGACAAGGTCAACCACATT
ATGCCTTTTAGGTTGCTCTATGAA
gtaagtgttagaccagaactccaacggtgtgagtgtgtgtgtgtgtatgtgtgtacggtg
tggggagcatcggtgtgggagagcagagagagagaaaaagcatgaaaggatgaagataca
ctctcgagagagaagatcgtttaaacaagcataaagagtttggagactccatttccacac

Exon  2 +      27238      27288   0    Initial     51    55    Marginal
tagttagttccacctatcaaaatcaaaagcatgttagttacttcctagatacaatgggag
tataggcattgggaaaatacacccattcaaactgggagaaattagccaaaacaaaggggc
tacaggccccaagcaagcccaaaatccagtaggacagtcattaagctttaaatttccaaa
ATGATCACCTTTGACTCTATGTCTCACATCAAGGTCATGCTGATGCAAAAG
gtgggctcccatggccttggacagctctgcccctgtggctttgcagggtatagcccccca
gccccccaatcctggctgctttctcaggctggcattgagtgtctgtggcttttccaggtg
catggtgcaagctgtcagtggatctaccattctgggatctggaggatgatggctctcttc

Exon  3 +      46117      46154   0   Internal     38    84        Good
ggaattgtgaagaatatatactgatttatacagtatacatttacctggttttccttgtga
acacattcatttgtagaaagtagaaaaaaaaaaaccaaaaacagctgctgatgatcatcc
agtaaattataatagtaaagacaaatatctaacttacattctattcccctgctggcacag
GGAAGTAAACTCATTTTTGCCATCAAGAATAAGAAAAT
gtgagatgagttgaagaacactcattttaaaaataatttgtagattccaccaactcctga
acatcacattttctacatagaattttaagttttaagtactcccttgaatattacttagca
gcatagagaagtaacagagtatgtgattcgattctctgagtgtgagactggattgatata

Exon  4 +      54927      55044   2   Terminal    118    67    Marginal
gaagtattaagtgaggttatcaatctgcttctgtgtaagcaaaaatagtaaaatattttt
agtagtagtcagtaaaagtagaagctgaagaaaagaaaatacgtcagttgagagatacac
atcttaactgattgtcagtcaacgaatagtcattagctctttctatatgtttgacactag
GGTATATATTGTGGATAAAACGGTGAAACAAACAAATAAAACAGATGTTGAGGAAGACAA
GCAAACATACAGTTTCAATTGCTGCGAGTGCTGCAAAGGAGAAGGACTCAGTGCTTAG
atcttatgagagggaaattcgatgtcatcaggagggcgtggagtacttcctgaggaggtg
aaactgaagctgagacagaagggaggagaagtcaaggaggtacaaaaggaaaggaggaac
atccaggcagaaagaattgcctagtacacaaaggcctagtggcaggaaggagcatggcag

Exon  5 +      60481      60584   1   Terminal    104    60    Marginal
actacttgatctgctcctgtctgtgatataccatatatttttaacaaaaaagttattttt
attcattttattgctttagctccatatagtttatttccttgataaaattagaatatgata
gttcttatgaaactgacttgctgttagagtggtatttaatttttcttttttgttcagcag
GAACGAATGCAGGAATTTGGGAACTGAGCTGTGCAAGTGCTGAAGAAGGAGATTTGTTTG
GAGGAAACAGGAAAGAGAAAGAAAAGGAAGGAAAAAATACATAA
tttcagggacgagagagagaagaaaaacggggactatggggagaaaaaagattcagatta
cgaggattatggatgaacgtaacagacaggtgagtggagtaaactttttttgtatcatta
tttattaattatattttctccacatatgttaagggtacagaaaatatcttgaatctgtaa

Exon  6 +      60620      60673   0    Initial     54    49    Marginal
gctgttagagtggtatttaatttttcttttttgttcagcaggaacgaatgcaggaatttg
ggaactgagctgtgcaagtgctgaagaaggagatttgtttggaggaaacaggaaagagaa
agaaaaggaaggaaaaaatacataatttcagggacgagagagagaagaaaaacggggact
ATGGGGAGAAAAAAGATTCAGATTACGAGGATTATGGATGAACGTAACAGACAG
gtgagtggagtaaactttttttgtatcattatttattaattatattttctccacatatgt
taagggtacagaaaatatcttgaatctgtaaatatctattaagagaagtttgggttaatt
aaatgtgaccagttaaagtgctgatagtctcttatatataaaggagaaaaaaatcacttt

Exon  7 +      61544      61662   0    Initial    119    64    Marginal
gtttggcattaaagacttgtatatcatgaatgcctgcaatttgactctatttttcttcac
actaggggagagtggatttagttaggctatgtaaggacagctgggtagtttgtataacgt
taaatatcaaataatggtcctgggagaaattatagtactgctgggtcccaaccatctcat
ATGGATCATGGAACCTGCAGAGAAGACGTTTCTGGACTGTGGAAGAGAAGAGTGTTTTGC
CTACTTTTCGGTTACACTGAAGAAGGCTACACAGTAGCCCTGGGGACAACCACCAGACT
gtaatttccccacaaatgtagacactcatgtcctctattgtcctgttttgtcttcttgga
catacaaataggactagaactgattgattcatttttttaaatgtaatgttgtttcatgtg
taaactataatgaataggaattaattatttcttgcatcaaagtcagtacgccattaaaaa

Exon  8 +      72957      73059   2   Internal    103    64    Marginal
atgtatgggtgggattgagtaactaaaacataggagattctgtagggtgcatgcttggtg
aaccatattgccatttgctcttaactcaaagccctatgatacttaggcatagattaagaa
catctaaaaattagaataaatattttaaaggtctctagtccaacttcctgcttaattcag
GAGCCCCTTCTACACCTTCCTTGATATGCAGCTCTATGTGAACATATTCAGAAATGAGCT
GCTTCCTGCTTGGTGGGAAGTTCTCATCACTAGATTTTCCCTT
gttttgaatctctttctaattttcaacaatgcttactaattttgcctcttcgcatggaca
tatgcttcagaccttagaaaatgtttagcatttcacttttaattctatttttttctgagt
tatacattccagattctttcaatggttcctcatgccagattgttctcagaccctacatca

Exon  9 +      79607      79827   0   Internal    221   100   Excellent
ttttcaaatgataagcagaaattaatattagatttatttgctttctttctgaatgtgtta
gtgcccagggctctgacaactacacaccattgttttgtgaaggaaaagaaaaaagaaaag
aaaaaaaccacacatgcatgaatattttttaaaaaatcttggctgctttcttttttctag
GTGACATTTACAAAGAGGAAATTTGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTG
TGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCC
AGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGC
CGGACAAACTCAGACATCGTGGAGGTGAGAGAGCATGCGTG
gtgagccccaagcctccgcaagcaggggagtttggacctccccctgccacacacacatac
acacatcatgttctttttcttaagatgttcatagtcccatagatagacccaggattatta
tctatcgcaactcttactccaccttttctctccccttcaaaagttagagtgatgtgatga

Exon 10 +      85309      85474   2   Terminal    166    53    Marginal
ctccctgggacagagcacctaggggaaggggcagctgtgggcgcagcttcagcagactta
aatgttctggcctgctggctctaaagagagcagcggatctcccagcacagtacttgagct
ctgctgagggacagactgcttcctcaagtgggtccctgaccccccgtgcctcctgactag
GAGACACTTCCCAGCAGGGGTCGACAGACACCTCATACGAGAGAGCTCCGGCTGGCAACT
GGTGGGTGCCACTCTGGGACGAAGCTTCCAGAGGAAGGAACAGGCAGCAATCTTTGCTGT
TCTCCAGCCTCTGCTGGTGTTAACCCAGGCAAATGGTCTGAAGTAG
acctccagcaaactccagcagacctgcagcagaggtgcctgactgttaaaaggaaaacta
acaaacagaaaggaatagcatcaacatcaacaaaaaggatgtctgcaccaaaaccccatc
caaaggtcaccagcatcaaagaccaaaggtagataaatccatgaagatgaggaaaaacca

Exon 11 +      87491      87668   1   Internal    178    92   Excellent
ggacttcagcattcttctcagcaccatatcacacttatcctaaaactgacataattggaa
gtaaaacactcttcagcaaatgcaaaagaatgcaaatcataacaaacagtctctcagacc
acaatgcaatcaaattagaactcaggattaaaaaactcactcaaaaccacacaactacag
GGAACCTCAAGAACCTGCTCCTGAATGACTACTGGGTAAATAATGAAATTAAGGCAGAAA
TAAGTAAGTTCTTTGAAACCAATGAGAACAAAGACATAGTGTACCAGAATCTCAGAGACA
CAACTAAAGCAGTGTTTAGAGGAGGTGAATTTATAGCACTGAATGCCTACAGGACAAA
gtgagaaagatctaaaattgacaccctaacatcacaattaaaagaactagagaagcaaga
acaaacaaaagctggcagaagacaagaaataactaagagccgaactgaaggagatagaga
cacgaaaaacccttcaaaaaatcagtgaatctaggagctgattttttgaaaagattaaca

Exon 12 +      88451      88735   0     Single    285    46    Marginal
cctgttgccaaaaccaggcagagacacaacaaaaaaagaaaatttcagaccaatatccct
gatgaacatcgatgcaaaaatcctcaataaaatactggcaaaccgaatccagcagcacat
caaaagcttatccaccatgatcaagtcagcttcatccctgggatgcaaggctggatcaac
ATGCACCAATCAAAAAATGTAATCCATCACATAAACAGAAACAATGACAAAAACCACACC
ATTATCTCAATAGATGCAGAAAAGGGCGTCGATAAAATTCAACACTCCTTCCTGCTAAAA
ACTCGCAATAAACTAGGTATTGATGGAATGTATCTCAAAATAATAAGAGCTATTTATGAC
AAACCCACAGCCAATATCATACTGAGTGGGCAAAAGCTGGAAGCATTCCCTTTGAAAACT
GCACAAGACAGGGAGGCCCTCTCTCACCACTCCTATTCAACATAG
tattggaagttctggccagggcaatcaggcaagagaaagaaataaagggtatttaaatag
gaaaagaagaagtcaacttgcctctgtttgcaggtgacatgattgcatatttagaaaacc
ccattgtctcaccccaaaatctccttaagctgataagcaaattcagcaaagtctcaggat

Exon 13 +      90403      90546   0     Single    144    43    Marginal
ccatttgacccagccataccatttctgggtatatacccaaaggagtataaatcatgatgc
tataaagacacatgcacatgtatgtttattgcggcactattcacaatagcaaagacttgg
aaccaacccaaatgtccatcaatgatagactggataaagaaaatgtggcacatatacgcc
ATGGAATACTATGCAGCCATAAAAAAGGATGAGTTCATGTCCTTTGCAGGGACCTGGGTG
AAGCTGGAAACCATCATTCTCAGCAAACTAACACAGGAACAGAAAACCAAACACCACATG
TGCTCACTCATAAGTGGGAGTTGA
acaatgagaacacatggactcagggaggggaatatcacacagcagggcctgtcgtggggt
ggggggctaggggagggatagcattaggagaaatacctaatgtagatgacggttttatgg
gcgcagcaaaccaccatggcacgtgtatacttatgtaacaagtctgcatgttctgcacac

Exon 14 +     110379     110567   0     Single    189    45    Marginal
ttctctgaccatttgacaacatcctgaaactctaacaacttctacctccaggtcaactgt
tgaacctgcaaggagccttttccccagatctctgacttccagtcggcctttctgcctctt
gttcactagagagtacatcctggtttcctgtccttatgctaagtctgatgaaaccccagg
ATGTCTGTCTGCTGGCTTAACTGGCCCTGGATCAGCAACTGTCCCCTGACCAGCAACCAT
CTACCCATTATACCTTTCACTGCCTCTGTTAAGCAGAAGGTTTGCCAGTATATGAACCAA
TACAGTGAAAACACTAATATTGCATTAGCCAAGTCCCAGGAGAGATTTTACATGGAAAGG
GAGAAGTAA
tatacaagtaagactagagaccaagactgctcaccttttacagacctggcaaacctgact
aaaacgcgagagaggtttggttttcaagggggaacatttggattcctagccactagcttt
tgcttagtctgcctgagcctctccattgtatatcatcaggctgtccttaccattagtccc

Exon 15 +     112551     112629   2   Internal     79    69    Marginal
aagttttgttctcaacatgtttgtgtcttcctggcagtaacagagcagcagcagccacag
atggcttggaagcccatcatgccccagactctgagcaggtctaaacacagagaaatccca
ccatttgtgaaccagttacaatagtctgtgtcacctcctccattccctcagctcccacag
GGATGTCCTGTGCCGCAATCTTGAAGTCATTCCAGATATTGCTTTAACCTACCAGAACTT
GTACTCCTTACATTTTGAG
gtaataatcttattaaaacaaataaatagtactgtcactctacaagaccacccaactcat
ttgaattagtgtctgtcactgttagaaagtatgactgtcaagtttgtttgcttattcatt
tatccagtgaaccataactgagaatcttggttgagtccacacatattacccaagccctgt

Exon 16 +     123080     123223   0   Internal    144    83        Good
ttaaactgctgatgagcactcgattgaaatgactcagctttcatctgtggtttctcttcc
ctaatagaataaagcatatgtaataacctgaaatactggacagcttgaacttctttaatg
cccctgaatgtctcttacagcctttgtctaggtttgaactttccaaattatgtatttcag
ACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCC
GTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTA
ATGATCAGCAGGCAAAGATTGTGT
gtaagtactcagaacacccttcattttttttactcttgatatttctctgaacctggcagg
cattgaacaagaaagaaaacaaaggctgtgaaagccccgatcccgactcctcttatgcac
tcaccccacgcactgaagaaaaatacaaaaaaattaatgaagaatttgataatatgatca

Exon 17 +     123283     123420   0   Internal    138   100   Excellent
tggctgtgacagcccagaccccgatgcggacgattccgtaggtcacagccctgagtctga
ggacaagtacaggaaaattaacgaagatattgatctaatgatcagcaggcaaagattgtg
tgtaagtactcagaacacccttcattttttttactcttgatatttctctgaacctggcag
GCATTGAACAAGAAAGAAAACAAAGGCTGTGAAAGCCCCGATCCCGACTCCTCTTATGCA
CTCACCCCACGCACTGAAGAAAAATACAAAAAAATTAATGAAGAATTTGATAATATGATC
AAGAGTCATAAAATTCCT
gtaagtaccaaaggtagatggctggtctgctgataactgctgcagtaacataccttaacc
ctctcagtgatggctttctctaagactcttcggaaagtcaaacagataaatagccatctc
atcccacgggcagctcatttagaaagcaaaccctaaaggatgctgagattatgtaatcta

Exon 18 +     125979     126088   0    Initial    110    51    Marginal
cactctgccctttgtatgtagagagtgtctccacctctttaaaaacattacaagactgtt
tttctatttcgaagacccagtttgaagagtttcccttttaaaacagaaaatttaatattg
cagtcacctgttagtatattgtaatttatgcccatattcctcaattacataaaataattc
ATGGGTGATTTGGAACTGTGTCGAGCAGCATTTCCTCATGCTGGGTTCGCCATGGTTCAT
GCTGGGCTTCACAGCAAGAGAAAACACCTCCGTCTGAGGAACCAGCAGAA
gttaggaaaggggctgaatgaatgagaggcgggtgcaagttggttgagagtaaaagggaa
gggaggaagtggaaagaaacagtatgtattttcttcaaaataatgggctgtgaagagaga
gaaataatgttgtatgtaggatcaagggaggagttaaaatgaaagcgcttgagattattt

Exon 19 +     132365     132542   0   Internal    178    58    Marginal
agcacatttaagaaatcaatttatgatctgaacgtcttgagagctcttcttaatggtctt
ctagacacaaagtagtttggaatgtagaatttttcttggaaaaataagggctgtctgtct
tgaagagcttctgttattaattcttttcttttacctttgttttgttttctgttcctgcag
GCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGT
TTGGTGTACAGCAACCCTGTCAGCTCACTGGGAAACCCCAACCTATTGCCACTGGCTCAC
CCTTCTCTGCAGAGGAATAGTATGTCTCCTGGTGTAACACATCGACCTCCAAGTGCAG
gtaacacaggtatgtcctcataaggatgtaatgctaacaaatagttggaaggaaccattt
tcggcaaagccaacactgctttatctacgagatgttttctggttttccacttactctcct
tcatggcttaccatccacccccgagctaggtctcctgcatgatagagcctaaattcttta

Exon 20 +     135291     135338   1   Internal     48    99   Excellent
tttttaacgtttgagcacagcatggcacaataaaacaaatgtcagccatctgacttgggt
tgtactttacaagtttatgactattgcaagaggacaaaatactgaggttgctgaaggtaa
agtgttttgttctgtgggcctttagcctttctcgttttgatcttcctctttaatccatag
GTGGTCTGATGGGTGGAGACCTCACGTCTGGTGCAGGCACCAGTGCAG
gtaagcccagactccatactgcagtatgtatcattgttctgagttcttctactaggtgat
ttgcaggacaaagtcttttgaacaaataaagttaagagatctgtgagaggcatggaaaaa
tgacaccaagaatttttaaagcacttttctgaagcaggagtggttaaatagtaacttaga

Exon 21 +     137682     137857   1   Terminal    176    60    Marginal
gttttcacagtttctatatagctgtgaaagtgttacccatattttaaaaatagaggaaga
agccctttctaactctggtcccaaggaacacctgttgcagatgccacttagtctcaagct
tagctgtcatgtcctactcataaactcagccatcttccccttctttctcatgccaaccag
TATCATATGTCAGGCTGAATATATCCGTGCTGATGTCAGAGAATCACATAACACCAGAGG
AAAACAAGGCCAGCCAGAATGTTGCTACATTTTCAGAGAAGAAAACCAAAGCAAAAAGGC
CAAAATATAGCTTCCAAATTTTGCATATTGTCATTGAAATTCAAGGTTTCAGATAA
agtttgaaactcttgaggccaagtggcgagactgcaattacgttactttttagcagctgc
agtttttttctaaatcaagtcatctcactttgttaaaaaaaaaaaaaaagtgagagggag
ggagagtctcatgaggcaaggaagtaaattgaacatttattttgtgcctataaatactaa

Exon 22 +     148501     148565   0    Initial     65    91   Excellent
gaaggaggagaggggataatagaagatgacagtttggtagattaaaaaatggttatgcca
atggcagaattagccatggtccatagtgactaattctgtttatgcttattagtcttatat
gcttgtattcataattcaaagtcctagaaaagaaaaagaaacaagtgaagaaaactcaaa
ATGCCTAAACATCCAAATAAAAGAAAGTTTCAGAACTTTGAGCTCAAAGAGAGCTACATG
TTCAA
gtgagctctgtgagacaaggcaaaatgccttcctcataatatcttaagccaggaatatgt
tctttgaatttacgacttcttaaaataggagtcaataaaaaaaatgcagcaagtgtttgc
aagttaactggggagaaaaatgtttttctcctaacaccacattcaagttctatgtattga

Exon 23 +     152507     152712   1   Terminal    206    78        Good
agaggactattgaatacttaattgggttacttgtcccatggaggtcaaatcagtcatcct
atggttttgcaatgtacgtcttaccattaagcttttgtttttattctcatgttgtgtatt
cttcggaaacgtatttgacctagatttcttcctaaatgctttattgttttttgttaacag
GGAACGGGTATGGCAATCCCCGAAACTCACCAGGTCTGCTGGTCTCACCTGGTAACTTGA
ACAAGAATATGCAAGCAAAATCTCCTCCCCCAATGAATTTAGGAATGAATAACCGTAAAC
CAGATCTCCGAGTTCTTATTCCACCAGGCAGCAAGAATACGATGCCATCAGTGGTAATAC
AAAACTACATTTTAAATAAATATTGA
taatgttttgtatatgttttgctgtttttatatttgtctaacttgatgaattacttaaca
ttctcccagaaaattaacataacagtgccattgacagagccttgcttgtatttagctatt
atttctggtaactggtttgcatttcccttttccgtgtaaaaaaaatatatatatatatct

Exon 24 +     153721     153851   1   Internal    131    59    Marginal
catttatttcttttttctttctctgctctgtggcaagcttcagggtaaaacagtcctgtg
agctgattagtttattatggcacagtgcagattaattttgaatatcaaccaaaaacatca
cataatatgcaacattcccttcagaaaaaaactgggtctaataaatataacctcctacag
GGCTACAGCCAAGCAGTGTGGGCCGTGCATGGCAGGCCATCTCTATCAACAGATTTATTC
CAGGTCCCTTAAAACTGATGCTGTCCCAGGGAATCTGTGATGGGTCAGTTAGGTCCCTCT
CTGGCAGCCAG
gtgtgtagctccccttcctccagcaagtgaggtttcaaagcacagtctttttttttcctt
caaaatgaagtgatgaaataatgaacattgagacactgacctgggctgaaaaccgggtag
attgtcttcacatttgagacaaacagctcattaagggaaacaaagaatgtctttgtaagg

Exon 25 +     155780     155915   1   Internal    136    80        Good
tattccttttaaattagaattatcgctgatgctttatctcccctcccctcaaaattaaaa
atatctataataacgataatcctaatagaatattttggaaattgaaaatgtttattctat
ttaccatttgataatttctaaatttaatattttcccttgttgttttattctttaatctag
AGTACTCTCTGAGTAGTGCAGACCTGTCATCTCTGTCTGGGTTTAACACCGCCAGCGCTC
TTCACCTTGGTTCAGTAACTGGCTGGCAACAGCAACACCTACATAACATGCCACCATCTG
CCCTCAGTCAGTTGGG
gtaagcaatattattttttataatataattttagaatgtattttgaaaaacaaatgacag
tctctaaatatgtgcttcaatatcccattaacgggtataaaactctactttattgaaatc
caagtgtaattttcagatcaatacttttcaagtagcttaaatcttatatacctgtttttt

Exon 26 +     161579     161804   2   Terminal    226    49    Marginal
ttaagctgatgtttgatttaattgtgagttcctggggcctccaggcctccttcatctgta
actgggtttcctttcctcctacagagcttgcactagcactcatttatctcagagttcaaa
tctctccctgccttctactcaaagcctcaacatcaagtcagaacctgtttctcctcctag
AGACCGTACCACCACCCCTTCGAGATACCCACAACACACGCGCCACGAGGCGGGGAGATC
TCCTGTTGACAGCTTGAGCAGCTGTAGCAGTTCGTACGACGGGAGCGACCGAGAGGATCA
CCGGAACGAATTCCACTCCCCCATTGGACTCACCAGACCTTCGCCGGACGAAAGGGAAAG
TCCCTCAGTCAAGCGCATGCGACTTTCTGAAGGATGGGCAACATGA
tcagattattacttactagtttttttttttttcttgcagtgtgtgtgtgtgctatacctt
aatggggaaggggggtcgatatgcattatatgtgccgtgtgtggaaaaaaaaaaagtcag
gtactctgttttgtaaaagtacttttaaattgcctcagtgatacagtataaagataaaca

Exon 27 +     162086     162244   0    Initial    159    76        Good
tggaaaaaaaaaaagtcaggtactctgttttgtaaaagtacttttaaattgcctcagtga
tacagtataaagataaacagaaatgctgagataagcttagcacttgagttgtacaacaga
acacttgtacaaaatagattttaaggctaacttcttttcactgttgtgctcctttgcaaa
ATGTATGTTACAATAGATAGTGTCATGTTGCAGGTTCAACGTTATTTACATGTAAATAGA
CAAAAGGAAACATTTGCCAAAAGCGGCAGATCTTTACTGAAAGAGAGAGCAGCTGTTATG
CAACATATAGAAAAATGTATAGATGCTTGGACAGACCCG
gtaatgggtggccattggtaaatgttaggaacacaccaggtcacctgacatcccaagaat
gctcacaaacctgcaggcatatcattggcgtatggcactcattaaaaaggatcagagacc
attaaaagaggaccatacctattaaaaaaaaatgtggagttggagggctaacatatttaa

--------------------------------------------------------------------------------