--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16103 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        130        169   2   Terminal     40    90   Excellent
agtttttgttgggggttgaggaggaaggaaagtcatggtgttctgacgtggaaaacttct
ttaaaaggctgcttagtctttagtttgaaaataaaccaaaaaggtttaggagtcggggaa
aggccctagGAAAATCCAGACAGTGGTCACGTTTGTGGACGACGTTTAG
agcttgctatcctgggcacacaagaacccttggactgttcggtgcaaagttggcaaatcc
tacacggcctgtgccagggtttactttctgcatcaatttcacaggcgtccagcctggctg
aggattttttgcggtttttaactggaagggaaataagtcggcatcagcacttagggctgc

Exon  2 +        371        471   0   Internal    101    72        Good
aagaacccttggactgttcggtgcaaagttggcaaatcctacacggcctgtgccagggtt
tactttctgcatcaatttcacaggcgtccagcctggctgaggattttttgcggtttttaa
ctggaagggaaataagtcggcatcagcacttagggctgcttaacttttaaaaggtggtag
AACGCCCAGCCTTACACGCTGCTGCTTAAATTCTCGGTGCTCACCAAGGCTGGGCTCGTG
TGGCCCAATCCTGCAATCCCCGAGGCGGTGTTTCTTAAAGA
gtgggcttgattctggttaaacccattaagaagtcggaccccgggctcgtttcttgttct
gtaattatgggtaaagtccaaggatctgcgttttgaagaggtacctaagtagttcatctt
ccttccccctacaactttttatttttaattagttaaaaatagttttacatttttgatatc

Exon  3 +       7584       7784   0   Terminal    201    79        Good
gaattacaggcatgagcctgatgcccgaccctaacttaactttagaattggcttgcagat
atgggacatgagtcaaaatacgtagaattaagacatttagggaacaacgatggtgcctaa
tatatttgagagaactgttttcaaagttagtaactctttctatccgccttcaccttttag
GAGGAAGTTAACATCCCTAATAGGAGGGTTCTGGTTACTGGTGCCACTGGGCTTCTTGGC
AGAGCTGTACACAAAGAATTTCAGCAGAATAATTGGCATGCAGTTGGCTGTGGTTTCAGA
AGAGCAAGACCAAAATTTGAACAGGTTAATCTGTTGGATTCTAATGCAGTTCATCACATC
ATTCATGATTTTCAGGTATGA
tttaggttattttaagatatacatgaacaatattaagagttgtctggatgatacagaaac
tatccttgctctcaaggaaattactatgtttgaaagctctaaagttgtattatgcagtag
catttttttcatttagcatgacatggtatatgtaaaccttaaagttaaattttgacacgc

Exon  4 +       9348       9576   0    Initial    229   100   Excellent
gaagaccagatgttgtagaaaatcagccagatgctgcctctcaacttaatgtggatgctt
ctgggaatttagcaaaggaagcaggtaatgatgactttataaaattttcataaaatatta
agtgattgctgagtttttagaaattaaggttttgtagatggttatttgtttttatatatc
ATGAAAAACCATTCTAAATTCCATGAAAGAGTAATGTCATGTAAACATTTAATAGATTTG
TCTTCTTTTTTTGTAGCTGCTGTTGGAGCATTTCTCATCTACATTAGCTCAGATTATGTA
TTTGATGGAACAAATCCACCTTACAGAGAGGAAGACATACCAGCTCCCCTAAATTTGTAT
GGCAAAACAAAATTAGATGGAGAAAAGGCTGTCCTGGAGAACAATCTAG
gtaagacctaatctatttagcccctgattgtttttgaagactttaaaaatcatttataca
tacacatatatatgttttaaatttaaaaagtcaatgaatatgaatcattagagaaaaatt
agaatatagttaataaagaaaataaaaaattctaagagataactactttgtgaatccttc

Exon  5 +      12100      12353   1   Terminal    254   100   Excellent
ctgtgcctggccttgaatatttttacattgcgttgtcacaagtgagctgtgtcattttgg
tatattttaattaaaaggcaaggtttctactttgatattatttaaatccacacccttgta
tcttacatcaaaatttaagaatcagtcagctttaaattatttgcttttattcttctctag
GAGCTGCTGTTTTGAGGATTCCTATTCTGTATGGGGAAGTTGAAAAGCTCGAAGAAAGTG
CTGTGACTGTTATGTTTGATAAAGTGCAGTTCAGCAACAAGTCAGCAAACATGGATCACT
GGCAGCAGAGGTTCCCCACACATGTCAAAGATGTGGCCACTGTGTGCCGGCAGCTAGCAG
AGAAGAGAATGCTGGTAAGAAGGATTCCTGAGTCCTGTCTTAGCGAAGGTCCGCTTTGTC
TTTTCCATGCTTGA
actttcacagctgtacttggagtgttactgagtgaaagccaaaagtgcttttttaaaact
aggagaccaaacaaaagtagtttacatatacactgtattcatgaagaataaaaatattat
gctcttctgtttgaatttatttcttatgtactatagatcccatcatttcttttattgcaa

--------------------------------------------------------------------------------