--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (47226 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        576        707   0     Single    132    50    Marginal
tcatccaggctcctgcagagcagcagtctcagcctgtgcctcaaccacagaaaagctgct
ttctgggcctgctggcctacactcagacatagtggatagacttcctagtgttactatgat
ggactgtcagtcacagcagagttcttcatatacagatctctaccctgaagtccggtggtg
ATGTGGGACTCTGGGGCTGTGCCAGCTGATGCCAGCTCTGGGACCCACCTCCTGAGGCAG
GAGCACGTGCTTGGGCACATGCAGCACACTGATGCCACCAGGCCTCTGACAGCCTGTCAC
TTTGGCGTATGA
atcttgctttttggttcatcatttcaaccagaatctatacactgagcagaagactggtcc
gtttgcttctctttaggcattctagaagtgatcatttttgaaacaatgcctccgtctcta
gacagctaggtgtaaatgaaccatttacacctagcttgcccacagggggcaagctgatga

Exon  2 +       1250       1371   0    Initial    122   100   Excellent
cagaacttggtcagattgactttatcaacttacagccacattgtcttacataccaataag
ttcagaactctcttacgtgagctgcgtatgtacttccggtaagaatgcacgttcattctg
tttttctttgaagggatctgaaacttgcccacccttcgggatattgcaggacgctgcatc
ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC
ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT
TG
gtaagtatggtctgttttaatagcgtggattgagtttttgctgtaataaaaagtaaaact
aaagtgtcaggatttagaaacattgatgattaaaaaaaaaactctgttataggtttatga
gctaaattgaatcaactgcttgctctagttctgtgtagtcaggctgtagggtacaaaccc

Exon  3 +       1812       2015   0    Initial    204    55    Marginal
ttcatttctcctgtcattatgatatcagagtagtaggtatgacagtgagttgtaacagaa
atttggagttttattcatttcttcatcatggccaccttttcccccctccccttttattcc
cgatcactcctgttcatttccaggcgccatcattgcagtgccttgccattcattggcagg
ATGAGGCCAGTCAGTGTCATTGTCACTCCATGGATTAACCAGGAAGGGATGCTGTGTGAG
GGGTTGGGCTGGCCATCTCTTCCTTGGTGTCTCACTTCAACTGTGTGTCCAGCCCAGAAC
GTCAGAATCGTTAGTCTGACCCTGAACGTTAGTCTCTTGCATGGTAAGACGGTCAGCCGC
CGCAGCATCACGGGCCAGCTCAAG
gtaaagctcttcacatgtttcctagactgcagctatcagcacttcccacactttttaccc
cttatttttctgggcagaacttttttttttctttttctttttctttttttttggtcaatg
aaaacaggattacctttgcgcctaaagaaaccgtggtgcagttaaacatcgcgtgtttac

Exon  4 +       2143       2200   2   Internal     58    62    Marginal
gtctcttgcatggtaagacggtcagccgccgcagcatcacgggccagctcaaggtaaagc
tcttcacatgtttcctagactgcagctatcagcacttcccacactttttaccccttattt
ttctgggcagaacttttttttttctttttctttttctttttttttggtcaatgaaaacag
GATTACCTTTGCGCCTAAAGAAACCGTGGTGCAGTTAAACATCGCGTGTTTACAGCTG
gtaggcagagggggttgagggagaagaaagctcttttcgatgctctagtagggtagttta
catttccttgtagagatgttgggtttggagaatctttaacgatgatttttaactgatcct
ttgttgcggagacctatgatcagggaaacagttgtttttttcagccctggcggctgaagg

Exon  5 +       6867       6990   0    Initial    124    60    Marginal
aaacagatccataggagatattggcattattagatccacatttttaaatagctatgatat
tacgttcaaggtgataaaggcaagattaaaagttttggtggagaaatgaaaacttctttt
aagaggaataaatcaaaattctagaagtaaaaactatagtaattgaattatgaatttaat
ATGTGTAACAGCATGCTAGATATAACTGAAGAGAGATTTAGTGACCTGGAGGAGAGGTCA
GCAAAAAGTATCCAGAATGAAAGCTGCAGAGGCAAAAATGGTAGAAGAGCCCAAAACAGA
GAAG
gtgttagttttctattgctgcataacacattaacacaaacttagttgtttaaaacaacac
ctattgattatctcatagttctatagtcagaaacctgggtgggtttgcctgggttctttg
cccagcatctcacaaagctgaagtcaagatttcgactgggctgggctcagctcacagatg

Exon  6 +       7878       8079   2   Terminal    202    59    Marginal
aaaatagagaaaactgaaatcgtggtgggatgtctgattttcagagttagaatatttaat
accatgaaggtcatttttcagacttgtctagagtgattgcaatcaaatctcagtcgtctt
aaaaaacaaagaaatgaacaaactgattttaaaatttatatgtaaaaataaaaaccctag
AATGGTCAAGACACCCATTAAGAAGGGAGGAACACTCCCTCTGCGAGATGTGAAGACTTA
CCATAAAACTGGTGATCAAGCTGGTGTCGTGTGGTGCAAGGAGAAACAGTGGACTAGCCC
TGAAACAGAGTCATGCATGTGTGGGCTTCTGACTTATGGCAGTGGTGGCCTGTGGAGCAA
TGAGGAAAGGCTAGCCTTTTAA
ataaatggacataggaatgttcatgtagaaaaaagtgaaatttgaccccaacctcatatt
atacacaaaagtgaatgtcagttgaattgctgtaaatatataaggcaagccagtaaagct
atttgaacataatataggagaatgtcttcatgatctttggggtagggaaggactccttta

Exon  7 +      17476      17589   0    Initial    114    44    Marginal
ctgaactataaaatgtttttctcaaatccctgatagccaggattttagggttcaggagtt
tatgagtattacttaaaatgattaagtcactaattctatttaagattctgtatttccaga
atcttaagtagaatcatcttactaacagtgaaatgaagtattaatctattgagaggcata
ATGCCCAACTTCATCCTGAATTTATTGGTGTGTTCAGTCATTAACAAATATCTGATTGCC
CTCTGTGTGCTGGGCACTCTCTGGGACTTGGCCTACCTGGCTTCCCTGGAGCCT
gtcagggaagatagacaagccacatgataaatgaggaaagcatgtagtccattagaatgt
gctaggtgctgtggacaaagggtggagctgggtcaggggatcaaaagtgctgagggttgg
acttgaggctgcagttttaaataaggtggctggggaaagacctccatgagttggtgacat

Exon  8 +      19989      20127   2   Internal    139    97   Excellent
aagacgttaagtttgttatttatatattctttggaaaatttttagaaagttccattatac
caagttatctttttactttagccagtgcagtgattggaagtaagttacagtttcatgaaa
tttagtcataaaggaactttggataattttcaaataaataactgaccttttctccctcag
GTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCACATGGAGCTGGA
TCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAACATCTGCATTC
AGCTGGTATAATTCATAGA
gtaagtggtgatgtattaattttatttttaaaaacaatcatttggttgtcataatccttt
acatacaaaataacatttaaaaaaaattgttaggcttgaaaatccaaatagatgatggaa
tcatatggtgttttaagagagtcattctaggaggcatctgtggagccgcctggcctgcca

Exon  9 +      28450      28485   2   Internal     36    65    Marginal
tacttggactttcaataaaatgaaaacttctccaagtgctacccttgcctcttctgcctc
catagcacctgcatttcacttgctgagcctttcctgggtgtcgtggccatttatagaggt
tggcatttccttcgctcagctagggcatttgggcggccctgcagcttcctgtccctgtag
CGTGGGGCTTTTCGTGGGCGGCTTCCGCATGCCACG
gtgggttagacaggcgagggactggccgggaggaggcctgtgcgagaaggaagggggagc
agccagaggaggcagcaaatgctagctgaacgtagtgcagtcctggcccctcagaggcct
ggtccagactgcggtgcagctctgagggcctccggtgtcacacaggaacgggcctgcctc

Exon 10 +      32673      32891   0   Internal    219   100   Excellent
gctttaggctgatttgttttagtttcaatttgagagtaagattttccaaagttgttccca
aatctcagagttcagttcactccctacactctcacactggcttcacgaccctcacggatg
tgaagtagtttatttagcatgcttcattcattttactaatttaagccatttctttcctag
GATTTGAAGCCTAGCAACATTGTTGTGAAATCAGACTGCACCCTGAAGATCCTTGACTTT
GGCCTGGCCCGGACAGCGTGCACTAACTTCATGATGACCCCTTACGTGGTGACACGGTAC
TACCGGGCGCCCGAAGTCATCCTGGGTATGGGCTACAAAGAGAACGGTGAGTATAGCCGG
GGCTGGAAGAGGCTGGGATGTTTAGAAATTGCTCTAGCG
gtggtctcgagttttttctctttcctttgaaccatatgatatatactgtggggactgtta
cacccagaatatagcatgatccagagataagaaataattaattgtgtttttccattggtt
aaaatcattctcttttaaaaattcacttttaaaattgttatttttgaactttttaatcag

Exon 11 +      33618      33700   0   Internal     83    72        Good
tgaaatgagttttgctacaggttcatcttgctgcgttgtagcttgtgttcccaccctgag
gggcacagcttcatgtgcttcctgtggaggggagagaaaacttgatcccctgttcacttc
tcccctcggcccgccagcagggcacttagaggcctctgctgtctgtctgaggccccacag
ATGAGGGTGGGCACCGTGGAAGTCTGGGCCCCTCTAGCAGGGCCTCACCTGCAGTCCTGC
AAGCCAGCCAGCCTGTGCCGCCA
gtgagtgctgctgcctttctgacggggcagtctagaaaatgatcgctcaggaggtgtggt
atcaacaacgcacagaggctcccgccggcaagctagtgacgtgtaccgggtttgtcctgg
gagggggtttgaagaaaaaagatgggggactctagctggtttttaatcccctggtgtttg

Exon 12 +      39112      39238   0    Initial    127    48    Marginal
aaattccgctgctgatccagtggggtggcctagtcgataggtttaaatattattcaagtg
atgctgccgcatgtactgtgaatacaaggtacttcagttgtattttcctcaagaaactcc
ttagatattgatcagtggaataaagttattgagcagctgggaacaccatcagcagagttc
ATGAAGAAACTTCAGCCAACTGTGAGGAATTATGTCGAAAACAGACCAAAGTATCCTGGA
ATCAAATTTGAAGAACTCTTTCCAGATTGGATATTCCCATCAGAATCTGAGCGAGACAAA
ATAAAAA
gtaagatatcctttttttcttatacttgtgttttgtaattcaggtggtgctttcactctt
tcatgtttgtattctaaaaacctgtgttttgggagagaaagtcattttaggcctgaagtc
tgaggtacgaaggcactgaggagagaaagcttaaaggtctagaagctttatcctctataa

Exon 13 +      40656      40780   1   Internal    125    89        Good
gagactccgtctccgaaaaaaaaaaaaaaaattttgggttatattcatcttgaacctatc
aaacatttctcaaaattaatatatctttgttctatctgtgttgtcatatttagttcttta
ttgtatgattctgtttgtttcatattaacagcattaatttaatatttgttgtcaccctag
CAAGTCAAGCCAGAGATCTGTTATCAAAAATGTTAGTGATTGATCCTGACAAGCGGATCT
CTGTAGACGAAGCTCTGCGTCACCCATACATCACTGTTTGGTATGACCCCGCCGAAGCAG
AAGCC
gtgagtatctgttttgaaaagatttatatagagaggccaggcttatatttccttggatct
tgtctgtccgtccagagtggctacatatgggtagcaagttctccatttgggggctcccag
ttacagaaaggccaagtgttgtctgagacctgggtcgcttgctcttttgctgctggagcc

Exon 14 +      45280      45427   2   Terminal    148    49    Marginal
ttggcccaaagaaagactcaaggaaaagttcagaaagtccagctgactgacttcttgtct
atactcatagttaggattgggaaactgcaaaaggacagagccgagaaatggcctgcagtc
tcgctgcctggatttgcagcaatgtcgtgcctcagattttattatatttggttttcttag
CACAGATGCAGCAGTAAGTAGCAACGCCACTCCTTCTCAGTCTTCATCGATCAATGACAT
TTCATCCATGTCCACTGAGCAGACGCTGGCCTCAGACACAGACAGCAGTCTTGATGCCTC
GACGGGACCCCTTGAAGGCTGTCGATGA
taggttagaaatagcaaacctgtcagcattgaaggaactctcacctccgtgggcctgaaa
tgcttgggagttgatggaaccaaatagaaaaactccatgttctgcatgtaagaaacacaa
tgccttgccctactcagacctgataggattgcctgcttagatgataaaatgaggcagaat

--------------------------------------------------------------------------------