--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (27457 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1276       1797   0     Single    522    84        Good
gccgcaggcggtgctctgggtccgggagcgctgtccccagcatgaacgcggccggcggcg
ggagtgaatgactgcagctgcgacttccttcccgggccgcccgagcctccttccccaccg
actttcttgttttgattaactccgtggactcctgactctttcttcgcccggaacatcaat
ATGTGTCATGTCATTGTCACCTGTCGCTCGATGCTCTGGACCTTGCTGAGTATTGTGGTG
GCTTTTGCCGAGCTCATTGCCTTCATGAGTGCAGACTGGCTGATCGGGAAAGCGAGGAGC
CGCGGCGGCGTGGAGCCGGCGGGCCCGGGCGGGGGCTCCCCGGAGCCCTACCACCCCACC
CTGGGCATCTACGCCCGCTGCATCCGGAACCCAGGGGTGCAGCACTTCCAGCGGGACACG
CTGTGCGGGCCCTACGCCGAGAGCTTCGGCGAGATCGCCAGCGGCTTCTGGCAGGCCACA
GCTATTTTCCTGGCTGTGGGAATCTTTATTCTCTGCATGGTGGCCTTGGTGTCCGTCTTC
ACCATGTGTGTACAGAGCATCATGAAGAAAAGCATCTTCAATGTCTGTGGGCTGTTGCAA
GGAATTGCAGGTAAGAAGGCAGGACCCCGGGCACGGTGGGATGGAGGGATGGAGAGCTGC
CGGTGCAGCGCACTCTGGTACTGGGCATTCGCTTCCTGCTAG
ttttggagaagaccactttctgtctattcaggtttcctttgccccttccgttctaggcga
cgtttgtgtgctgctcgcatgggtctctttcccctgtcttaccccacaggaagacaggct
tgttctctggtcttacgtggtcctcctcattgcttatttcctcggggtctaagctgttgg

Exon  2 +       2394       2493   0    Initial    100    59    Marginal
ggctgggaaggaattagtatcagctgctctgtgtttagtgatgttctggtttaaattgtc
tgtctcctagagcctgacagaatgttctgtgcattcagatcagaaaatgcaagcgaactc
ttccattttctgggaatttctcactaacgagcttattagaaatgggtggaaagtaaaagc
ATGAGCTCTTTACAGTGGTCCCAGGGAGAAGGTTGTGAGCTGCAGGAAAGCATCCACTGC
TACCAGTATTTTCGTAGGCTTCCCCGCATGGGTTTGAAAG
gtgagtcctgaaccaatggggtaacaatctgtctaggtttgattcaaggttcttgttctg
ggtgacagaaattcacacacaaaaacacatggctgagtttgaatacatccccaaagaagt
agagtagactcttgctttgatattcagaaaacaagtgcttactttttaaccaagacatta

Exon  3 +       3056       3162   0    Initial    107    43    Marginal
agcagggctggcttccaaataaacagatcaaatgacagttttttcccaaacagccgataa
gataaagtttactgttcctcagatcttaggaggcccctgtgtagggtggaggtgggggat
ggggagtaatgggccaagagaaatgacagagggcctgctccttagttctgatttgctttc
ATGGGGGAATACACCATCCAGACACCAGGCCCTTTAAACTTTCTGGCCCAAAGGGACAAG
TCTCAGGTCCCTCATCTCTACATCTGCCAGGATCAGCCACACCACAA
gtgactcaggcactcatggaatttgggagaccaggattctgtatttcagcattgctcctc
attagcagtttcacttgagataaatgtaccaccccgggtctcagtgttctccttctgaaa
aatagggagattggaaaatgtgaccttcctttggactttttaggcttagagtttgattct

Exon  4 +       4742       4857   0   Internal    116    76        Good
gctttaacttcctccctacccctgttacttatgcagcatctcaaaaattctgaaattact
cagaattttaaattggcacaaggcagagattcctgcatagtttgactgctgtctaggagc
cactgatctaagactaagtgctgaaatacaggaaagaactggtttcttttctccttccag
CCTAGCATCACCCCTCAGAGAAAAAATCATAAAAAAGAGGGACTGAGCTATCCTTCTCAT
GATTCAGTGGGCACTTTCTCCCCTATTGGAGGTCTCATCATGCACATCAAGCCAAT
gtaaagggcagctgtggttcttgaatctgtggctgaggacattgccatactggcatctga
aagggctggcttgctttctcccgttggccaatctgtgatagcctctggtcagccccagcc
tcagcaaggacttgctgcagctgggagcatctgccttttctctccctatgccccctctcc

Exon  5 +       6678       6764   0   Internal     87    96   Excellent
tgagccaccggccagctgcctgctatcttccagtcttccctttatgctgggctggctctc
acactctactccctccagccctctgcctgcatgggtctcagtccagcaggacagccttag
caagctgccccaccagtctgaccagatagattgccctggggctgaaccctgcctctgcag
GGCTGGGGTGAAGGGTGTGTGGTCGTGGGAATGGCGCTGGCAGTGGCGGTGAAGGGCCTG
GTGTATGCAGGCTCAGCCTTCTTGGAA
gtgagcaatgattgagggtgaaagaggacaacatgaaaaaaagcaataaaaggaaaagca
gagacagacacgtgggggttttgcctttgctgcttatataattgcttttgtcataaatct
gatgcatggaagtatgggtgggcatacgaaatgcagctgatcactctccaggatttggta

Exon  6 +      16768      16915   2   Internal    148    77        Good
tacgtttgcattgggaacacagtgataaaactgtgttcctctgtgtagcctctgccctca
cggagcccagtctgattatttctgttaaatgcaaaccacgtatttagattccccaaagaa
actctgaagattcttgcacgggtagataaaacttctgtgaggaaaatatgaaaatggcag
TGGGGTGTGGCAGGTGCTGCGCTGGGATGGCTGGTGCCCAGCTGATTGGGAGGGCGAGCA
CCAGCTATCCCAATACAATACCATGACCATCGGTGAGGTTGTCAAGGCTCTGTCTCCAGC
TGGAGGTGGCACCTGTTGGGCAGTCCAA
gtgactgaccatcagcttttcatttgtttttttcctctacagataaggttgaatcatgtg
atccccccattgccagcagatgctaacgtcttctaacctccttggtacaatgaggctgtt
agaacacggggatgaggatgttggagtcttttaaggttatgaaaattgttaccttctagg

Exon  7 +      22336      22592   1   Terminal    257    84        Good
tctaataatgtgatacttcttgatcaggtcagattagtttgcatgaaacagtcccaacac
tttctattgcagaatagatgcccttgcccaaagcaagcaaatcaagtaacaattacaaca
gatctggacagttgtagcaccatggggattttctaatctgttttctcttttgttctgcag
GTCTATTCCTTATCCTCGGTTTGATACTCTACCCTGCTGGCTGGGGTTGCCAGAAGGCCA
TAGACTACTGTGGACATTATGCATCTGCCTACAAACCTGGAGACTGCTCCTTGGGCTGGG
CCTTTTATACCGCCATTGGGGGCACAGTCCTCACTTTCATCTGTGCTGTCTTCTCTGCAC
AAGCAGAAATTGCAACCTCTAGTGACAAAGTACAGGAAGAAATTGAAGAGGGGAAAAATC
TGATCTGCCTCCTTTAG
tttggaagagacaatgccattttctcccttgagtaatcttgtgaaacagtccacagtttc
atcatttgagtcaagtggagaactaacctttacctaccaaagccacgttccacggcccga
ggcttaaacaggaccaatgagaggccacatccagctacgcaaagttactggacatgcggt

Exon  8 +      23448      23644   1   Terminal    197    96   Excellent
catatgagaacaaaaatatgaaatcttgctagtgaagacgtattttttcttcttcccagc
agccaggctagcaccagttctggcccagtctcctcttcttctggagatcacatgtttttc
ttctaaggttaggattgtgctttgactgcgaaaggaaacctcactgtttcctccttccag
GGACTGAGGTCTCCAAGCTAGCTGTGGCTTATGCAGATGTTCACTGGGAGGACCTGCCAG
AATCTCGGCACTTGGGGGGAGACCTTTACTCCCAGTTTGGTGACCATGCTGTAGTCAGCT
CTATTTCCAATCCCGACAGTAGCAGAATGGCATTCTACAACAAAAAGAAGCTAGTTATGG
GAGTTAAGTTTTTGTAG
ttactggtgttgatcctgaaagcagactgagataacattaaattgctgcaactgaagaac
tgcagccaagaccttaattccaggaaagcacagaggacaaagttaattcaaaaagaggcg
ctagatcaaggtcacagcactgcctacacctgtttacaaaaagaatcaaataccactatg

--------------------------------------------------------------------------------