--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (40245 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1148       1479   0    Initial    332    87        Good
ctagctcttctctcccttttacattttaaaagaaacgattttcctttttgtatcttttaa
taaacttttcagctatatgtaagatctttaattgcatttaacaaatacctgtgaagtgtt
taatgtgtgcaaggcactgagttggaaaagtagccttttaaagtttataaatttaatctg
ATGAGGGTAAAAATTAATGTTCTTTTCATTATTTGTAAATATTATCTCCAACAGATCAAT
AAATCAGAGAAGCCAGAAAGCTGCGATAATGTGAAGGTTGTTGTTAGGTGCCGGCCCCTC
AATGAGAGAGAGAAATCAATGTGCTACAAACAGGCTGTCAGTGTGGATGAGATGAGGGGA
ACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTACTTTTGAT
ACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAGACCTATT
ATTGATTCTGTACTTGAAGGCTACAATGGTAA
gtgaatctttactttttaaaaaactcccttattgagacataattactgtgccataaattc
acatattgcagctgtgcagtttgatgagtgtagtaaatatatacagttgtgaaaccatca
tcacaatccagctttagaacacccttgtcatcctcaaaatttcctttatgcccatttgca

Exon  2 +       4737       4834   2   Internal     98    58    Marginal
agaattggtattatttcttaaatgtttggtagaattcatcagtgaagccatctgggcttg
aagttttctttgtgggaaggttttcaactattgattcaatttctttaatagacataagac
tattcagattatgtattttttctttttctctttaaatcagggtctcactctgttacccag
GCTGGAGTACAGTGGCACAATCACAGCTCACTGCAGCCTCGACTTCCTGGCCTTAAGCAA
TCCTCCCACCTCAGCCTCCCCAGTAGCTGAGGCTACAG
gtgtgtgctaccacgcctggctaattttttctattattattatttttttcttgaaacagg
gtctcactctgtcgaccaggctggagtgcagtggtgtgatcatggctcacttagcgtcta
cctcccgggctcaagcgatcctcccacttcagccccctgagtaggtgggactatatgtgt

Exon  3 +       9182       9326   1   Internal    145    61    Marginal
ttgtgcttgtggtacagagtacgcattgtaattgttgataataaaggtgaaacttgtgct
agaataaattttgaatccaggggagaaattacatcacagtgtcaaaggaattaattttaa
gagctattgttctgtagcattagactttaagaagtaactgattctcttcatcattttcag
GGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTC
GAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATA
TTGCAAAAGCGGAGGGTGATACAAG
gtaaaagggaattcttttattttctgatattgagaagtacaaacactggaaaggcacata
ggtataaattttataaacatattttaaaaccgttcttatgaatatttcactctttgactt
tttaaaaatgatgttttatagatttttggttcgagtgtcttatttggaaatatataatga

Exon  4 +       9454       9552   0    Initial     99    81        Good
aattcatttgctcacatatttggtcatattgcaaaagcggagggtgatacaaggtaaaag
ggaattcttttattttctgatattgagaagtacaaacactggaaaggcacataggtataa
attttataaacatattttaaaaccgttcttatgaatatttcactctttgactttttaaaa
ATGATGTTTTATAGATTTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTT
CGTGACCTTTTGGGCAAGGATCAGACACAAAGGTTAGAG
gtaaggataattgaaattggtggagtactttttccaaagcaatagaatatttgctaaatt
aaggtcccccttctttttttaaacaaaagttgctttttatattttaaataatctcgtaca
tatataatgtcgtacatctgcagacatatctggggataaattactgaagcaggattgctg

Exon  5 +      14966      15088   0   Terminal    123   100   Excellent
ttttatgtgtaattcttcatttgtatgttcttcctatagacatctccatgcgtgtaggaa
cagtgtctatcttatcagtatattccctctgtctagtagagtgtccaacacataggagat
actcaataaataattgtggaagagttattgatatagtataaagtcttaatttttttttag
GTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAAT
AATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATCGTAAGTATAGTGTG
TAA
ttgtgattaagcatctgtgtgttgagtaggctggtttagaagcaaatttggtatggcact
ttaccctgtagagactggattttttaggtttcttgaaaaccattccactttgattattta
ccatgtagagagcatagatgaatgaaagataccacaaatcattttccatgccgagcaaaa

Exon  6 +      15426      15462   0    Initial     37    44    Marginal
atcattttccatgccgagcaaaattttgtttctttttagtagcgccaatctatgcaactc
tcatacggctgtctcttggtagctataatagtaaaattggtaatgtttattgagctctta
gtggagagtgcttgtgctaagtgcttcataaagatgctctcttagtcctcacaggagact
ATGAAGACATTAAATTCTTACTTTATGAATGAAGAAA
gtgagacttagtttaagtaacttgtctaagtactataactactaagtggtagagtgagtg
atcacacctaagccatagccacgcacagtggctcatgcctgtaatcccagcaactcggga
ggctgaactgggaggatcatttgaggccaggagtttgagaccagcctggacaatagggag

Exon  7 +      18716      18835   0    Initial    120    66    Marginal
catgtagtggctaagtacacacccatgcctttatggtttagccatgctctctggcttttg
attgtgataaaattaagtgttttaaactgttcaggatgtttaattatttttaaaggcact
ctctgttacacttttaaaggatttcgtttatttattaaaggttctgttggtgcaactaat
ATGAACGAACATAGTTCCCGTTCCCATGCCATCTTTACAATTACTATAGAATGCAGTGAA
AAAGGCATTGATGGTAACATGCATGTCAGGATGGGGAAGCTCCATCTTGTAGATCTTGCT

gtaagtaacaggacactgcttaaggaataactctttcttgtgatccatttattttataaa
tgaatgaaaattaaagtgaaaaggtatgatttacatatgatttttaaggtgttacttgtg
tatgtttattatttattatggaacatttcaaatgtatatgaaagtagatagaatagtata

Exon  8 +      19238      19435   0   Internal    198    95   Excellent
tcatggctaatcttgtttcatgtactctcccccacttcttcctttcctatattattttga
agtgaattcaggcatcatatcaggttttttactgttacattactttttaataaaaccttg
ggaagaatattctatttttaaaaaaattttagctttactttcatctctgtttattgctag
GGTTCAGAAAGACAGGCAAAAACTGGAGCTACTGGACAGCGCCTAAAGGAAGCTACAAAA
ATCAATCTTTCACTTTCCACCCTTGGTAATGTAATTTCTGCCTTGGTTGATGGAAAAAGC
ACTCATGTGCCTTATCGTAACTCTAAACTGACTCGTCTTCTTCAGGATTCCTTAGGAGGA
AATTCAAAAACCATGATG
gtaagacttaattggtgatatagttaacatcaggcaaatttaagattgtaatttatgcca
ataattgatacgtatcacattttttaaacttgattattttactttttttgacttgtggtt
gtcctttttgtggtacactcgtgtattagcccataatagtgtcctttggaaactcatgtg

Exon  9 +      19749      19923   0   Internal    175   100   Excellent
tacactcgtgtattagcccataatagtgtcctttggaaactcatgtggttgacactctca
ttttcgagaaggccaagggtgcatatgtgctttaaatgtttttgatgtatttgtaatggt
agtattaattttaactctgtcaagtgtaaaatgatttgtttcatatttctaattcaatag
TGTGCAAATATTGGGCCAGCAGATTACAATTATGATGAAACTATCAGTACATTACGGTAT
GCCAATCGTGCTAAGAATATTAAAAATAAAGCTAGAATTAATGAAGATCCAAAGGATGCT
TTGCTGCGTCAGTTCCAGAAAGAAATAGAAGAACTGAAAAAGAAGCTTGAAGAAG
gtagcttttcctcaaaatattaatctttatgttggctaaaaatacattgttgaaccacta
actgttctaacaaaagccctctattaaaccttttttgagcctctaacattggtagttaaa
tgaatatttctagaaagtgacttggtacttacatactttcgcattttcatattaagctta

Exon 10 +      20245      20288   1   Terminal     44    79        Good
ttggtacttacatactttcgcattttcatattaagcttaagtaaaattacataatatttg
tgtatgtggttttttaaaaacatttgcatgatgttttgtagatttcatatgaccactttt
taaggaatgaatgtttatttgtctctgtataagagcaaattctgcaatgtatgtatttag
GTGAAAATGACCAGAATTCTGGCATTGCAATCAATATCAACTAA
ctattgtttgaagtaaagcaagatattagacagtcatgagtaaaccaagtttgctataag
gaaaaatgcattgcatgacctttaaaatatcctttcatacctaaatttgaacatgagatt
gtattttggaaattcttttctaacaatatcatgctagaaagttggaaaatttgaagatct

Exon 11 +      21414      21484   1   Internal     71    57    Marginal
aaaaaattgtggttaaacttgcataacataaagtttaccattttaatcacatttaagtct
acatttctgtggcattacattcacattgttctgcagttatccgtcttcagttttcttctt
gcaaaattgaaactttgtactcattaaaaacagtatgtacccattcctcccttcccctag
TTCCTGGCCAACAACCATTCTGCTTTGTCTATGAATTTGACTGCTCTGGGTATCTTACGA
AAGCGGAATTG
gtggggcgcagtggctcacgcttgtaatcccagcactttgtgaggccgaggcgggtggat
cagttgaggtcaggagttcgagaccagcctggccaacacggtgaaaccccatctttactg
aaaatacaaaaattagctgggcatggtggctctcgcctgtaatcccagctacttgggagg

Exon 12 +      26702      26773   1   Internal     72    94   Excellent
gaatattggataaactaccaagattggtttttaggaaagtaaattttggttctttaatac
aaagcttgattgtcctttaaaatttttttctctgaaaactgaatttttctctgtgtgtgt
gttcattttcttgtttcctctttctttggttcctgttgggctcatttctttgttttccag
GCAGTAGCAGCAGCAGTAGTTCAGACTCCACATGTTCTGTCATAGAGAAACCTCTGGATA
AGTTCTTGCCTA
gtgagtggtagctcttacattctctaacagagctttggcttttccataacccatgggctt
catttgagcaatgctgcaccactccctgtcattacctaaagaatacatgttggattcctc
agtagaacaaagcatgtgatgattcctccaccccctttcattgcttccagttaatcataa

Exon 13 +      30947      31037   0   Internal     91    76        Good
aaagagttaaagcctattaatgattcttcatttcatagttcctgaaaaaatatactcagt
tatatatctccatcataattatttttcagttctttttccttgttaggtggtgggggttag
cttttgggtggagacattaacaatttatacactcttatgatttacactcttcttctgtag
TTCTTTGGGAAGGAAGTTAAGAATGACGGAAAGGTTCTAGGAGAGCCTCAGACCAATTCT
GTGAAAAGTGTTATTGGTTTTCTGAAGGAAT
gtatgtttctaagaaactgtatgaccagaaatgaattgtctttgattcagtttcatcacc
agtttaataagctagttttattttctctttttcatttggattttgttattttgaaattca
ttaataaactttctttgagcacctattacatgtatgtaaaatactttattagacattatt

Exon 14 +      32082      32217   1   Internal    136   100   Excellent
ggaaatgcatgatattattggtttgatttccttaaaatattgataattggttttgtatta
ttgaggagtgtaggcatttctatattgaaggaggtaatttatataagtctgaaacattga
ttcattttagtgattgttgcaattaaatgattcaaataggaaaaaagaaagtctccccag
ACAAGATGATTGAAATGCAAGCAAAAATTGATGAGGAGAGAAAAGCACTTGAAACAAAGC
TCGACATGGAAGAAGAAGAAAGAAACAAGGCTAGAGCTGAATTAGAGAAACGGGAAAAAG
ATCTTCTTAAAGCCCA
gtgagtattattgaattgagatgaattcatgatttaaatttctgttttttcctaggatat
ataaaataggaaaattgaatagtaattaaaagcttggatttttgtctccagtgtagctat
tttggatagaagggtccattgtatatagtgtatttctaaaaactagatctattttggtta

Exon 15 +      32615      32795   2   Internal    181   100   Excellent
tagaatgagttataaattaagttagaaatcgatactacacagtggtgtaatttggcagag
atgttacataattatatttctattttgaaattgtatatccaaattttaaattttgggaaa
tgatattagtagaataatagatcatcagtgaatatagagtattctcattctaatcaacag
ACAAGAGCATCAGTCTTTGCTGGAAAAATTATCTGCCCTGGAAAAGAAGGTAATTGTTGG
TGGGGTTGACTTGTTGGCCAAAGCTGAGGAACAAGAGAAACTTCTTGAAGAATCTAACAT
GGAACTGGAAGAAAGGAGGAAAAGAGCAGAGCAACTTCGCAGAGAACTTGAGGAAAAAGA
G
gtaatgtgactttctgtttttagtttggtattttgccagagagatttaacttttctagtg
gaaagctaaatatctataatcgtattgaaattttaaagcatatttatggattgctttgaa
gatcagatttgctaaacatttatgtcatttgttaaagaattagatatttgattttacaaa

Exon 16 +      33012      33122   0   Internal    111    98   Excellent
cagagagatttaacttttctagtggaaagctaaatatctataatcgtattgaaattttaa
agcatatttatggattgctttgaagatcagatttgctaaacatttatgtcatttgttaaa
gaattagatatttgattttacaaagaaatttattctgaagtttactaatttttgtcatag
CAAGAACGCTTGGATATTGAAGAAAAATATACCAGTTTGCAAGAGGAAGCACAGGGAAAG
ACCAAGAAGTTAAAGAAAGTTTGGACTATGCTGATGGCTGCAAAGTCAGAG
gttggttctcttagaaattacctactaatgcagttctggattttttaaaagggagttctt
tgattaagaatttataaataatcataatgtgagcttataatttaaaagaaataaaatatt
tctttatgtgcaatttttaattttatctattagtctaaattgtttcttttcaaccttaac

Exon 17 +      33468      33621   0   Internal    154    94   Excellent
cttttcaaccttaacaaatagtgtagaatagatgctgatagtgtcacgctgtttatcatt
tttataaaagaactaggtaagctctcacaaggtttcttagacaagcatcctatgtgagat
ggtgctgttttgtagttaaagtcttgtttgttcataatatttttatggattttctggtag
ATGGCTGATCTCCAACAAGAACATCAGAGGGAAATTGAAGGCCTACTGGAGAACATTCGG
CAACTTAGCCGGGAGCTTCGACTTCAGATGCTTATTATTGATAACTTTATACCTCGGGAT
TATCAGGTAAAAAGGAAGTTCTCTGACCGAGATA
gtcgcttgactgggattaaggaacaaagatttctaatttaactgatgataaatacttaat
acttcagttattgaatgtacaattttttgaacaaatgccatcacatttcactttagttgt
taacttttaatacataatctctgtttgagtatctagccttttagacgaactcagattcat

Exon 18 +      35415      35464   1   Internal     50    55    Marginal
aggggctatgtgggactaagtgacctctggggccctttctgctctagcattcaaatcatg
ttttactagtgtaatgttaggatttctcagttatttgcctaactcacagtattgattact
aattaagacatttctctgtctctcccttttctttttttgagaaatgtgttgcttatacag
GAAATAACATGAGGAAGCAAACCCCAGTACCTGATAAAAAGGAGAAAGAT
gtaagagtacttaaaaaaaaacaaaacaaaacacaaaactactgttgtttctttatagga
atatgagtcattaaattgtattatcaacttgatatctgttaatcagctctgctgaaaaat
gggctgatacttttgggaataaaggctctaggatggggtgatgaggaggacagttctgct

Exon 19 +      36385      36509   0   Internal    125    85        Good
accaacctttattaagtacattttagatactgggattagaagatgatgtcattagacatt
tctttggttttagcttctgtgggtttgatcaaggagtttattcagtattttaaatcttcc
cccaaatctggctttaactctttgccttaagagtgctttgtgtttgtttcttttacttag
CCCTTTGAGGTGGACCTTTCTCACGTGTATCTTGCCTATACTGAGGAGAGTCTGCGTCAG
TCTTTGATGAAACTAGAAAGACCACGAACTTCAAAGGGGAAAGCAAGGCCAAAGACAGGG
AGAAG
gtaaggactgtccttgaatctggtaaaacgaaggcattgaggtattctaattagatacat
gtacaggaagttaaaatttatttagttaaaacatgatacatattttggctgatttattaa
aaatcaaattcctggctgggcacagtggctcacgcctgtaatcccagcattttgggaggc

--------------------------------------------------------------------------------