--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (4949 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1514       1597   0   Internal     84    91   Excellent
cttgaagacaagctgggttaactgctctaacatgatcgatgaaattataacacacttaaa
gcagccacctttgcctttgctggtgagtagcttggataagactggcctgcagcagtgagg
ggtggtggctgcctaaggccaaaaggcctcatgggcctttctctcccttcacccccacag
GACTTCAACAACCTCAATGGGGAAGACCAAGACATTCTGATGGTAAGAGCTCAGCCCGTG
GATCCCGATCCACTTCCTGCCTGG
gtgacttcagccatgtcattccatcttacctagccttgctttcttcatctgtaaaatagg
gttaatagcacctatctcagtgggattgttatgacaatcaaatggcacaatgtgcatgtt
ctggcccagcatctggcacttaagagttcaatacatggccacagccatggctataataat

Exon  2 +       2859       2948   0   Internal     90    75        Good
cactcacttctaggcctgtgcccttgggcagggacccacctgaggcaagaacgggactag
gagggaacccgaggatgtccccaacagtgggcttgggaaactgtgggggtgacttccacc
tgcttgtgggagggatactctgtaacctttcccccttaagtgtattctctgccccgttag
GAAAATAACCTTCGAAGGCCAAACCTGGAGGCATTCAACAGGGCTGTCAAGAGTTTACAG
AACGCATCAGCAATTGAGAGCATTCTTAAA
gtatgtgaagctgttgagggtttgggatccctgtgttggccctgccctgcctctggggag
gagagcagggcccactccctttccaagggaatctctgaccatctgctttggtctctttcc
acagaatctcctgccatgtctgcccctggccacggccgcacccacggtaagctgtccccc

Exon  3 +       3073       3203   1   Internal    131    70        Good
tcaacagggctgtcaagagtttacagaacgcatcagcaattgagagcattcttaaagtat
gtgaagctgttgagggtttgggatccctgtgttggccctgccctgcctctggggaggaga
gcagggcccactccctttccaagggaatctctgaccatctgctttggtctctttccacag
AATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGGTAAGCTGTCCCCCAAGA
TGCCCGTCATGGCTTGCTCCTCAGCTGGTCATCACCATTACAGCCTGGACTCACCTAATG
CCACCTTCTTG
gtttctttatagcgacatccaatccatatcaaggacggtgactggaatgaattccggagg
aaactgacgttctatctgaaaacccttgagaatgcgcaggctcaacagacgactttgagc
ctcgcgatcttttgagtccaacgtccagctcgttctctgggccttctcaccacagagcct

Exon  4 +       3216       3338   0   Terminal    123    68    Marginal
ggaatctctgaccatctgctttggtctctttccacagaatctcctgccatgtctgcccct
ggccacggccgcacccacggtaagctgtcccccaagatgcccgtcatggcttgctcctca
gctggtcatcaccattacagcctggactcacctaatgccaccttcttggtttctttatag
CGACATCCAATCCATATCAAGGACGGTGACTGGAATGAATTCCGGAGGAAACTGACGTTC
TATCTGAAAACCCTTGAGAATGCGCAGGCTCAACAGACGACTTTGAGCCTCGCGATCTTT
TGA
gtccaacgtccagctcgttctctgggccttctcaccacagagcctcgggacatcaaaaac
agcagaacttctgaaacctctgggtcatctctcacacattccaggaccagaagcatttca
ccttttcctgcggcatcagatgaattgttaattatctaatttctgaaatgtgcagctccc

--------------------------------------------------------------------------------