--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9836 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1250       1282   0    Initial     33    83        Good
ctcccaactttccggccctcaaggggtgaccaaggaagttgctccacttggctttccaca
aacagcctgtgccccaccaggctcaggagggcagcttgaccaatctctatttccaagacc
tttggccagtcctattgatctggactcctggataggcagctggaccaacggacggacgcc
ATGAGGGCTCTGCTGCTCCTGGGGTTCCTGCTG
gtgagcttggagtcaacactttcggtgagtgctgtgggaaccaggattgtcccaggattg
ttctggggggtcgctatcacagccatgagccatggcctctgctcatgacctgtgggtcca
ggtgactaggaggcctatgtggaaaggtgaggccagcccggaaggcccaggcagaggaga

Exon  2 +       1674       1731   0   Internal     58    78        Good
cagcctgcatttctgggggagatgggccttaagaagacaacggggggaggtagaaagggt
ttgggtcttgggaagaaatctctgcatttctgggctgtgagaggaagctgcagactagca
acagatcggtggcaggctatgacttatagtcagttccctgccttcttctctcccttgtag
ATTCCACCTTGGGAAGCCCCCAAGGAGCATAAGTACAAAGCTGAAGAGCACACAGTCG
gtaagtggcctggctcctcctcccgggaacccttgggtggggatgtgtatggtgcagtgt
gtgcagtctcagggcagtctagtctagtgcctacctggtgctaggtcttatgcccatggg
cactagagtgatcgtgagctgtgtgatccttgagggcagggtatgggctgtgtctaagtg

Exon  3 +       4717       4816   1   Internal    100    51    Marginal
gctgggattacaggcttgagccaccgcgcccggccctgaacccaacttttagagcagaaa
gtgttttcaatgcacagcgacctttttgagggtctgtccttttcctgaccagaccctgag
ggacagtgcctgagcagttgagtacaggggaagtcctcagagagtgtgttgtccctgcag
TTCTCACTGTCACCGGGGAGCCCTGCCACTTCCCCTTCCAGTACCACCGGCAGCTGTACC
ACAAATGTACCCACAAGGGCCGGCCAGGCCCTCAGCCCTG
gtaagactacgcagaggagttggagcaggggcctgggagacatgtaccctgcctgtcctt
ctgtccaaggaactctgcttggagagaggggactgtgatagggcagggtgggccaggccc
ctgggtagagcagggaagccttgtctctttctacaggtgtgctaccacccccaactttga

Exon  4 +       4973       5043   2   Internal     71    56    Marginal
gggccggccaggccctcagccctggtaagactacgcagaggagttggagcaggggcctgg
gagacatgtaccctgcctgtccttctgtccaaggaactctgcttggagagaggggactgt
gatagggcagggtgggccaggcccctgggtagagcagggaagccttgtctctttctacag
GTGTGCTACCACCCCCAACTTTGATCAGGACCAGCGATGGGGATACTGTTTGGAGCCCAA
GAAAGTGAAAG
gtgctacacacagcctctggggtggcctggggctctctcctcccgcctcattactctcct
ggtatcaccagaccccacacacctgggattctggacccagccccttctctccctccacaa
taccctttggaagtccagagggagagttctgggaaggagtggtcccattttgcaggtggg

Exon  5 +       5593       5724   1   Internal    132    74        Good
tgtctctgtccacaacacctcactggaaaccactgccagaaaggtgaggagatgtggagg
acctgggcggggtgctgggggacaggggcaaccctgggcctacagaataggttgctggat
actcggagacttggcatggtcctagactctcctgagaccactatccctctttgtccccag
AGAAGTGCTTTGAGCCTCAGCTTCTCCGGTTTTTCCACAAGAATGAGATATGGTATAGAA
CTGAGCAAGCAGCTGTGGCCAGATGCCAGTGCAAGGGTCCTGATGCCCACTGCCAGCGGC
TGGCCAGCCAGG
gtgagcagatggttgggaacggaccagggaggagcgtcaggaagacaggctggcaggagg
ccgggtggtgtgccgggaaggagagctctctgggggggtctttaggcccaggggtggctc
actgcgttccctccccaagcctgccgcaccaacccgtgcctccatgggggtcgctgccta

Exon  6 +       6114       6279   1   Internal    166    82        Good
cccggtgggctacaccggacccttctgcgacgtgggtgagtgagggtctggggcaagcag
aaggccagcccccaggtgggacgggcttgccaggaaggaggagggagagtgcggaaagca
gatgagagggaggcaggagagcccagccttggctgcccagggagccccctttctcctcag
ACACCAAGGCAAGCTGCTATGATGGCCGCGGGCTCAGCTACCGCGGCCTGGCCAGGACCA
CGCTCTCGGGTGCGCCCTGTCAGCCGTGGGCCTCGGAGGCCACCTACCGGAACGTGACTG
CCGAGCAAGCGCGGAACTGGGGACTGGGCGGCCACGCCTTCTGCCG
gtgcgccgcgtggggctgggtgacccctccgccccagggctccgggctcccggcgctcta
acggcgccccgtcgtgtggctacaggaacccggacaacgacatccgcccgtggtgcttcg
tgctgaaccgcgaccggctgagctgggagtactgcgacctggcacagtgccagaccccaa

Exon  7 +       6317       6445   2   Internal    129    85        Good
ggccgcgggctcagctaccgcggcctggccaggaccacgctctcgggtgcgccctgtcag
ccgtgggcctcggaggccacctaccggaacgtgactgccgagcaagcgcggaactgggga
ctgggcggccacgccttctgccggtgcgccgcgtggggctgggtgacccctccgccccag
GGCTCCGGGCTCCCGGCGCTCTAACGGCGCCCCGTCGTGTGGCTACAGGAACCCGGACAA
CGACATCCGCCCGTGGTGCTTCGTGCTGAACCGCGACCGGCTGAGCTGGGAGTACTGCGA
CCTGGCACA
gtgccagaccccaacccaggcggcgcctccgaccccggtgtcccctaggcttcatgtccc
actcatgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctca
gtcccagaccccgggaggttaggaagtggggggggaaggaggagccgagagggcgccggg

Exon  8 +       6687       6837   1   Internal    151    55    Marginal
ctcatgcccgcgcagccggcaccgccgaagcctcagcccacgacccggaccccgcctcag
tcccagaccccgggaggttaggaagtggggggggaaggaggagccgagagggcgccgggc
gagctagattccggccagccggccgcgggctccccgtcctcagcccctgctcctccacag
CCTTGCCGGCGAAGCGGGAGCAGCCGCCTTCCCTGACCAGGAACGGCCCACTGAGCTGCG
GGCAGCGGCTCCGCAAGAGTCTGTCTTCGATGACCCGCGTCGTTGGCGGGCTGGTGGCGC
TACGCGGGGCGCACCCCTACATCGCCGCGCT
gtactggggccacagtttctgcgccggcagcctcatcgccccctgctgggtgctgacggc
cgctcactgcctgcaggaccggcgagtacccgcccgcccagagccgccccaggggccgcg
gctcctccgtctcccagcgcagcttccacgctgcacccgaacccgtgccctaccttctcc

Exon  9 +       7160       7296   2   Internal    137   100   Excellent
cttccacgctgcacccgaacccgtgccctaccttctcccgccccacccttctttccacgc
ccctccggagctcccggggaggaagctggaacacgggattggggttcgggagcagggggc
ttccccagaacgcttgtggccaggtctgagagcgctgcctctcccctaccccccccgcag
GCCCGCACCCGAGGATCTGACGGTGGTGCTCGGCCAGGAACGCCGTAACCACAGCTGTGA
GCCGTGCCAGACGTTGGCCGTGCGCTCCTACCGCTTGCACGAGGCCTTCTCGCCCGTCAG
CTACCAGCACGACCTGG
gtgcgtgggggcgccccgcggggacgggaagagagcttggggccccggcgtccccgcctc
acgctcctctccgcccgggttagctctgttgcgccttcaggaggatgcggacggcagctg
cgcgctcctgtcgccttacgttcagccggtgtgcctgccaagcggcgccgcgcgaccctc

Exon 10 +       7397       7495   0   Internal     99    97   Excellent
tgagccgtgccagacgttggccgtgcgctcctaccgcttgcacgaggccttctcgcccgt
cagctaccagcacgacctgggtgcgtgggggcgccccgcggggacgggaagagagcttgg
ggccccggcgtccccgcctcacgctcctctccgcccgggttagctctgttgcgccttcag
GAGGATGCGGACGGCAGCTGCGCGCTCCTGTCGCCTTACGTTCAGCCGGTGTGCCTGCCA
AGCGGCGCCGCGCGACCCTCCGAGACCACGCTCTGCCAG
gtggccggctggggccaccagttcgagggtaggcacaactgctaggggcaggggtagggg
aggagacctttgatcactgggttaggcggaagaagcccgcgactttggtatcgttccggg
tgcctacagaatgggtggcgctgacctgatgggttgtgagaatgtgtaggtgaatcccag

Exon 11 +       8318       8485   0   Terminal    168    78        Good
cgctgctcagccccggacgtgcacggatcctccatcctccccggcatgctctgcgcaggg
ttcctcgagggcggcaccgatgcgtgccaggtgagctcttagcccggttggcgcccttcc
ccgaggccgtcaggcacaaatctcaggtccacagcgctgagctgcgtgtttccgacccag
GGTGATTCCGGAGGCCCGCTGGTGTGTGAGGACCAAGCTGCAGAGCGCCGGCTCACCCTG
CAAGGCATCATCAGCTGGGGATCGGGCTGTGGTGACCGCAACAAGCCAGGCGTCTACACC
GATGTGGCCTACTACCTGGCCTGGATCCGGGAGCACACCGTTTCCTGA
ttgctcagggactcatctttccctccttggtgattccgcagtgagagagtggctggggca
tggaaggcaagattgtgtcccattcccccagtgcggccagctccgcgccaggatggcgca
ggaactcaataaagtgctttgaaaatgctgagaaggaaagctcttttcttcatgggtccc

--------------------------------------------------------------------------------