--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22545 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1343   2   Internal    143    87        Good
atgcctcttagcagtcatctgacataccagtgccttgggaagcattaccacctaaaaaga
ttttggagcctgtaagaccctgtgtgttgggttttgataacttaaataatattaatatat
aataatttacctatcacacatctgtaacctccacaattcccttttcatttctatcaacag
ATGCGGCATTCCAAAAGAACTCACTGTCCTGATTGGGATAGCAGAGAAAGCTGGGGACAT
GAAAGCTATCGTGGAAGTCACAAGCGGAAGAGGAGATCTCATAGTAGCACACAAGAGAAC
AGGCATTGTAAACCACATCACCA
gtttaaagaatctgattggtaaattaactcttgaactactagcattttagctctaatagt
tttaaatgatttgtcatttgcttatatagctttcatctgtcaaattgttttataattcag
tcaacaaatattcgtttagaaaatatttgagtacttattttagataggcgctgaggctac

Exon  2 +       7669       7735   1   Internal     67    92   Excellent
aagatagctctatctaattgtttttgtagcagctgaaactaaaataatttgagtgctgaa
accttagttatgctttgttagagatcatttgaaaatattccacacttaagcattcattgt
ttgaagaactagacagtttgtactcaggtacttacacctctttttccctcctcactctag
ATGAAATCGTGGACACTTTGGGTGAAGGAGCCTTTGGCAAAGTTGTAGAGTGCATTGATC
ATGGCAT
gtaagtttgttttttccttttcaaacattctgatgtttttggtggggaaagattcataat
tcagatgaaattttatttatttatttatttgagatagggcctctgttgcccaggcttgag
tgcagtggtgctatcttggctcactgcaactgccgcctcccggcttcaagtgattctcct

Exon  3 +      10991      11144   0    Initial    154    90   Excellent
gtaggccgttaccgtgaagcagctcgttcagaaatccaagtattagagcacttaaatagt
actgatcccaatagtgtcttgtaagtataactttcacctaggagccatcatattacatga
aatattcaggtttccataaactgaattattattttgctctgttttagccgatgtgtccag
ATGCTAGAATGGTTTGATCATCATGGTCATGTTTGTATTGTGTTTGAACTACTGGGACTT
AGTACTTACGATTTCATTAAAGAAAACAGCTTTCTGCCATTTCAAATTGACCACATCAGG
CAGATGGCGTATCAGATCTGCCAGTCAATAAATT
gtaagtacacttgataaatctttatttttatttatttatttatttatttattttgagacg
gagtctcgctctgtcacccaggctggagtgcagtggcgctctcgggtcccagcaagctca
gcctcccgggttcacgccattttcctgcctcagcctcccgagtagctgggactacaggcg

Exon  4 +      12072      12191   0   Internal    120   100   Excellent
aggaatttcacttctgagccttattatatcctgttgtttaaccaaaaagaagtaatcctt
ctttgcctttctcatgagcttactttgacaatcaagaagataattcatgtgctggccttt
tgagtagcgctataaaatgtatctattgagtttcatgtttactcaactgtgtctctctag
AAACGTGATGAACGCACACTGAAAAACACAGATATCAAAGTTGTTGACTTTGGAAGTGCA
ACGTATGATGATGAACATCACAGTACTTTGGTGTCTACCCGGCACTACAGAGCTCCCGAG

gtcattttgggtcagtagacaccaggctttctaatattataattgaagaagagatttttg
ttctttacagctttactggtggggtggggaagtatgatcttctcagcaggattcagaaaa
cgttttctattttcataaaaaatgtgtggacattgctataaatacttttcctgagtggta

Exon  5 +      20860      21000   0   Terminal    141    90   Excellent
tagaaaacgcaagtattttcaccataaccagctagattgggatgaacacagttctgctgg
tagatatgttaggagacgctgcaaaccgttgaaggtaaaagaaaaaagattaaaggttaa
ataaaccacgtgtttgcactattaataattttttttaaaacaaaaacatttctcccccag
GAATTTATGCTTTGTCATGATGAAGAACATGAGAAACTGTTTGACCTGGTTCGAAGAATG
TTAGAATATGATCCAACTCAAAGAATTACCTTGGATGAAGCATTGCAGCATCCTTTCTTT
GACTTATTAAAAAAGAAATGA
aatgggaatcagtggtcttactatatacttctctagaagagattacttaagactgtgtca
gtcaactaaacattctaatatttttgtaaacattaaattattttgtacagttaagtgtaa
atattgtatgttttgtatcaatagcataattaacttgttaagcaagtatggtcttgataa

--------------------------------------------------------------------------------