--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13006 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +         32        110   0    Initial     79    83        Good
tgagaatggatgttgaacacagaactgaaggATGAATGGGAGTTACCTGAATAGAACCCAGGGGCTTGAATGCAAGAAGAGGCGGGCATTC
CAGGCAGAGGAGAGCAAGG
gtaagggccccacgggaggcattcgagtaggagggtgaactatgatgacagaagactcaa
taacgatccaaagaaaccaaatgattgggcgccttctttcggatccgtgacttccagcgc
caggagtctctattggctcttataccgttgctctatgggatagcaatgtttttgtccttc

Exon  2 +        994       1071   1   Internal     78    53    Marginal
gcctttcatgaactatattattgctgctaccgtagaaatggaaagtgtgcaacactagat
ccaaaactacttttgacacttctgagactgtggccgcgcctctgtcaccttccaaaggcc
actaggcctttcctgagctggcattggcaacgcacactcttgcccggctaacctttccag
GTGGGCGGCGCACTGGCTTCACTGCTCTCCAGGTGGCCGCTGCAGCTGCCCGAGAGCGCA
GGCGCAGAGGCAGACCAC
gtgagagcctggccaggccttccggcctagcctcactgtggccccgcccctctcgaacgc
cttcgcgcgatcgccctggaaacgcattctctgcgaccggcagccgccaatgggaaggga
gtgagtgccacgaacaggccaataaggagggagcagtgcggggtttaaatctgaggctag

Exon  3 +       2023       2193   0   Internal    171    96   Excellent
ggtcggcggaaactgacttgtcacggccgcagagtagactctgggacccatgttttccct
cggaacccatttttagtcggctttctttctgggaacttctccttgtgccccaccttaatt
aacccttgacttactcgagccttcgtggatcagctcttaaagtggtcttgcttctttcag
AACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAACATGGCAGGCGCAAAGCGCGTT
CCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGGCCAAGAACAGCTCTTGGGGAC
ATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATGCCTATGAAGAAG
gtaactctcttcctgacctaacttctgtaagagcccgccttccaactgtggcctttgatg
cagaaacatttcattctctctgtttcatctacaggaagcaaaaccttcagctactggaaa
agtcattgataaaaaactaccaaaacctcttgaaaaggtacctatgctggtgccagtgcc

Exon  4 +       2288       2482   0   Terminal    195    60    Marginal
agcccggactgaggccaagaacagctcttggggacattggtaacaaagtcagtgaacaac
tgcaggccaaaatgcctatgaagaaggtaactctcttcctgacctaacttctgtaagagc
ccgccttccaactgtggcctttgatgcagaaacatttcattctctctgtttcatctacag
GAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCAAAACCTCTTGAA
AAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAGCCAGAACCTGAG
CCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATTTTGGTAAACTTA
TTCTTACCATTGTAG
agtctgttgattatttcttgtcccttatttcactgatacatgcaagagcattcaaatgaa
tagtaatattaataccatttattgagtgcttagcatgaggcaagctctgcctaacatttt
acatgcattaactcacataatctttacacgtactctctgaggtattgtcacctctactat

Exon  5 +       5409       5567   0    Initial    159    81        Good
ggaataaatctgaaaagatacttttcctttaaggaaatgaattgtatgccgattcagcag
aatactagcttgagttggtaccaataacctgaacttcatgcccaaactatagtgcttact
tctatttgctatttcaagatatctctttgtttcaaggttgatactgcctctccaagccca
ATGGAAACATCTGGATGTGCCCCTGCAGAAGAAGACCTGTGTCAGGCTTTCTCTGATGTA
ATTCTTGCAGTAAATGATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGTGAA
TATGTGAAAGATATTTATGCTTATCTGAGACAACTTGAG
gtaagtattatcattcgttttttttctaaactgcatctaactttatgaaagtattttcca
tcaatagtttataataatacaagcaggacgtgggcagcatttcttaagagatcgcacttt
caaattctccttcatggaatacctataataaaaagtcactaaataaaccaatggagtcta

Exon  6 +       8366       8524   0   Internal    159    92   Excellent
atgtttgctttatttcttggtgatggtgttgtttgtggttgaccatatgaataattgaat
taagaactgatatagattataaatgccccagtgctactgtaggaactaactgatctttct
ggacataaatgtgtcacatggagtcatgtttctaagaataatcagcattttcttttgcag
GAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAACATGAGA
GCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAGGAGACC
ATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAG
gtgagcatttcagtaagagttttcccttccaggattctagccgagtcataagaaactgat
gttttcaggccagtctgggcgcagtggctcatgcctgtaatcccagcgggcgggtggatc
acaaggttaggagatcgagaccatcctggccaacgcagtaaaaccctgtctctactaaaa

Exon  7 +       8992       9099   0   Internal    108    80        Good
agagcgagactcaaaaaaaaaagaaagaaataaactgactttttcaactaaaatctttct
tgggggatatggtgtcattaagattttgctatgggagaatgtctttctacctctccttca
tcatagctctgtgtctccttttcaaacattttattcaccctattgaaattcccattgcag
AATAATTGTGTGCCCAAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCA
AGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTT
gtgactgacaacacttatactaagcaccaaatcagacagatggaaatgaagattctaaga
gctttaaactttggtctgggtcggcctctacctttgcacttccttcggagagcatctaag
attggagaggtacaggtttcttgagaaacctctccgtatgggtacattagggggaacact

Exon  8 +       9512       9652   0   Internal    141    97   Excellent
tggggaagggataaagttgttctttatttctagtcaggctgcatgttaatattaggactt
tccatgggcatttgagagtttgtagacaaacatttgtagttaaagatacatatgggcatg
caggttagtgccaaaggaaaattttctgaaagaaactcagtaacatgggttttgtttcag
GTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTAT
GACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAA
ATTCTGGATAATGGTGAATGG
gtaagctgtgtcccacagaactcctaagcttttaaattttaaagagtgactaaatacaga
acttttgttattaaaaggcaattcaagtggttcataaatatgggatctactgaaggaata
gttaaaaaagatgtcttagaatgtttccacatctttttgtttttgagacaaggtctcgct

Exon  9 +      11408      11464   0    Initial     57    45    Marginal
aaatttcagttatattaattatacagtacccatctcttttccactcctgaataacatcta
acatctagaaactttatgaaaatcattattgatttgagcatttttaacattaacttgttg
ccttagacaccaactctacaacattacctgtcatatactgaagaatctcttcttccagtt
ATGCAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATG
gtgagtcaatatagtggcattgtaagatgctgaaaagtgtaataattcaaacttaatgcc
tgcaaatgcctggtttatttttaatgagttaatgttttaaatgaatacctgtatcattgc
atcttgtgattttttttcttttgcctctttaattgctatctttttgtcttccagactgtc

Exon 10 +      11639      11746   0   Terminal    108    91   Excellent
cacatggtgagtcaatatagtggcattgtaagatgctgaaaagtgtaataattcaaactt
aatgcctgcaaatgcctggtttatttttaatgagttaatgttttaaatgaatacctgtat
cattgcatcttgtgattttttttcttttgcctctttaattgctatctttttgtcttccag
ACTGTCAAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTG
AATTCTGCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAA
cttgtaaacttgagttggagtactatatttacaaataaaattggcaccatgtgccatctg
tacatattactgttgcatttacttttaataaagcttgtggccccttttacttttttatag
cttaactaatttgaatgtggttacttcctactgtagggtagcggaaaagttgtcttaaaa

--------------------------------------------------------------------------------