--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (93466 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      12656      12740   0   Internal     85    87        Good
actattattatttggccatgatttatttattaataatgaataataggtaatatatataag
gtgcgtgctttgagagtgatctgaatttttttctcagcatacttaaatgtcaagaaatac
agaatcatgtcttgaagttatttagaatttcatgttaatatattgtgttctttttaacag
GAAGTACTTAAACAACTACAAGGAAGTATTGAAGATGAAGCTATGGCTTCTTCTGGACAG
ATTGATTTATTAGAGCGTCTTAAAG
gtagattttaaaaaggtgttttaaaataattttttaagctcaaattgtcatctttaggtg
tgtagatccaagtacagcttctctcgatttgggtgttggtatcagttttcttggtatgtt
agccttaccctcaggatgtaattgttaaagtacaaataaataaaaaatgtatttgtgtgt

Exon  2 +      21959      22067   2   Internal    109   100   Excellent
aatgactgtaatattctaagtcctacctttaaaaattgaaatcaatgtaaattttttgag
taattcattattagcactttaggtagagaagtttgcaataacaactgatgtaagtattgc
tcttctgcagtctttattagcattgtttaaacgtacctttttttaaaaaaaaaaaaatag
GTCATTGCTTCTTGCTGATCTTGACAAAGAAGAAAAGGAAAAAGACTGGTATTACGCTCA
ACTTCAGAATCTCACTAAAAGAATAGATAGTCTTCCTTTAACTGAAAAT
gtaagtaacttggcagtacaacttatttgaaactttaataacttgatattttaaagtacc
taggtaatccattaaaattcaggataactgaatttatagttatttgtaaattgcaatatg
ttttacccaactttaggcctgaatatataatagttaatgaatttttgttggtaaagatga

Exon  3 +      27120      27233   0   Internal    114    90   Excellent
ttgagtctgacacctataatcaaatttaaacactccttggagtaaaaaataattttctca
tgcaccatgactgacgtatttgcttattcattttctttattggttcttatatgctttttt
gcttttactgattaacgtaaatacaagatattgatacttttttattatttgtggttttag
TTTTCCTTACAAACAGATATGACCAGAAGGCAATTGGAATATGAAGCAAGGCAAATCAGA
GTTGCGATGGAAGAACAACTAGGTACCTGCCAGGATATGGAAAAACGAGCACAG
gtaagttacttgtttctaagtgataaaacagcgaagagctattaggaataaaatgaatta
cagctctgttaatattgattaaattttattaaagacataaggctgtgtttattttggctc
tatttcaaaataagatttatcatggctgctgagcaacataatcaatattcacatagttgt

Exon  4 +      38776      38859   0   Internal     84    85        Good
aaagaaaaattgaactgaccccaatttgttattaaagggtgaatatatttatatgtctag
ctttttaaatgagaatgatttgacataaccctgagcttttaagtggtagccatagtatga
ttatttctattaatattattaataaaaacataactaattaggtttcttgttttattttag
CGAAGAATAGCCAGAATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTA
CAGTCCCAAGCAACAGAAGCAGAG
gttagtaaattgcctttcttgtttgtgggtataaaaataggtagttattctgagaaaaga
aaacatgtataatttaatgtgacaccattgaaatatagatgttctttcagagaatttaaa
taccgtaatttttttcgtgaaattaaattatcaaagatttggactattttgattttatct

Exon  5 +      39214      39319   2   Terminal    106   100   Excellent
ttatctaacttttaggcagttaaaatttataaaactgtaaatatagataccttactttag
ctgtcagtttacatataatcaaatagttaacttaatttggctactatccagtaagtaaac
ttttttatagataatccatagtaagaattgataatacacatttacctgtgtttactccag
AAACCCCATTAAAGTGATAGTAAAAGGATACAATGAAAGAGGCATTAAGACCAGGGAAGG
TGACCACAGTAAAATCCGTGGAGCTGGAAAGCAGGTAAACAAGTGA
taacattctagcatatcagagagggttgacccataaggcagcaataggaatgaaaagtca
tgaagcaactagatacctctgggtgtgagagtaaaaaagggttaaaagcaggaagatatt
tgaaaatctgttaagaagcagatggactttccagaacctccctacaaccctgtacagcta

Exon  6 +      44146      44301   0    Initial    156    81        Good
cattgggtggaatgggagctgtgaggacaatgcagtgtgtcttaaaagataatagcaaat
gaagaatacttactaaagtcacagtattcttgcaactcattaataaagataaatacaact
caccttttaagtgggcaaaagatttaaataggcatttcaccacagaaggtatatatagga
ATGGCAAATAAGTACATGAAAATATGCTCAATCATTAAGGAAATGCAAATCAAAGCCCAA
GTGAGATACTGCTTCACACCCATTATGATGGCTTTAATCATAAAGGCAATAATAAGCATT
GACGAAGATGTGGAGAAGCAGGATCCCTCATTGCTG
gtgggaatttaaatagtacagccaccattttaaaacagttgagtgattcctcaaaatatt
aaacatatagttatgtgactcagcaatcttactcctaggtatctggccaagagaaatgaa
aatatatgtgtacacaaagacttagacttgtatgttcattcactagcagcattttttcat

Exon  7 +      47609      47702   0   Internal     94    98   Excellent
accgagatagtcgaccgccaatcgtactggaggttatgaagtgtaatacacagttccatg
cctttatcagtctgtataattgatgcattcagagctttaaagcaaaaaaagaaaaaaagc
cttgggctaagaaagcctacaccatttttgcatgtactgatgttaactccatcttaacag
AGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGT
CAAGGAGTGGGAGAAATCAACATGGCAACTTCTG
gtaatggtcaggtaaataaattattttatcatattttttaaaattatttaaatatcagaa
aagtatgaagcaagatggttctaagaatgatctataaatcttacctattttcttagtcct
gaatgcatatttccagaagcattcagtaccaatgtgctgtcatttctctttattatatca

Exon  8 +      65549      65674   0    Initial    126    50    Marginal
ctatgtctagctcccaagacagctgtatatccatgcgacagtctggatgtcttcctctcc
tcatccagcttttacatggcaatgacaaagactctgtattgttgggaaattcccggggca
gtaaagaggctcgggccagggccagtgcagcactccacaacatcattcactcacagcctg
ATGACAAGAGAGGCAGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGCGCTT
ACTGTGAAACCTGTTGGGAGTGGCAGGAAGCTCATGAACCAGGCATGGACCAGGACAAAA
ATCCAA
gtatgttctctatagtgtacatcgtagtgcatgtttcaaagcaaatgtgaaatttttaaa
cagaaaacatgtttagttaatatgctgtctttatgactaagaggagaaaattcatatcag
ccatttgtgctactcatatttaaaagattaagtctgtatttccctagaaaaatttagcaa

Exon  9 +      66083      66232   1   Internal    150    68    Marginal
ttatacaatcatagcatagtagggccttagtagagctagaaagaacttgagcaattatgt
tgcccatctttcacttcatagctgaagctcatttcatagatgaaagtgactttacgtaag
ttcctatagccattagtgtccaaaccataatcttttacatttgcatatcattatattcag
GGGATACAGAGCAGCGTTACATCTGTTATGTTATTTGCTCCTCACATCAACCTACTGAAG
TAGGAAGGGAAGGTATTATCATCTCCATTTTACAGATGAAAAAACTGAGGCTCAGAAGAG
CTAAAGGACTTAACCATGGCCTCACACCTA
gtaagtggtagacccaggaacagagcccagatctcctgactctcagctcggtgctcttcc
tactgtaccatccagctgtagacagtgggcctcagttgctgggagtgataatccacccag
ctcttcactcaggaagggacccttagacctcagccccactcccgcaggagcagcatggga

Exon 10 +      68226      68321   1   Internal     96    93   Excellent
tcctattttttgttccacatttgtagtatttattcatcctttcagcaaatatttgttgat
ccactaaaattccgtgaattagggttatattagtgatccctgcatatttttaaagtacaa
taaacatcattgctcttcaaataacaaagcattatggtttatgttgattttatttttcag
TGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAG
gtaagacaaaaatgttttttaatgacatagacaattactggtggatttttaaatcatggt
agaaattcagtatagtaaataaagatttttaatcattgatgaattaggatataaggccac
caacttctgttatcagctgcttcctctgtgtagcaaaaaattgtaccctggtttccagca

Exon 11 +      69637      69805   1   Internal    169    73        Good
taacaggaaggggataaaaaataatgaataaacaggaaaacattcagttttaagatacct
caaaagttattctgtaaatgttcctgtattccaatggattgtagactaggactgagacat
taatcatctggatttcaaaataaaacctagactcagtatttgttcctcttccttcttcag
GTAGGAAGGCTACCCGGGGCATTTCATCACAGGAGCTAGGGCAGGGGCTTTCAGGTGAGG
AGCAGGATGGGGCCTCTGGGGGTGTGACTGCTGGGGACATAGCCACAGGGGATTACCTTC
TTCTCACTCCTCACCTCCAGATTTGCACTGGGGCAAAAGGAGGATTAGG
gtgtgtggattgcggggagataatagtacaagacagcacaaggttttggcagtaagggat
aaggagaaaagaaatcccaaataggtaaaggggaattccttagttcagtcagctgggatg
gtcatttgtacatatatgaagattctacagctatcagtcatttaagtttgcacttattag

Exon 12 +      73438      73577   1   Internal    140   100   Excellent
taaatatattatacagaagttctttataacagtttttgtagcttataattctaaaggcaa
atttaaaccatatattctcattgattgagtttttttttcctagtatttaagttaccaact
tggtaccagtttgttttattttagatgattgtctttttcctcttgccctttttaaattag
GGGGACTACAGGCCATTGCAGAATTATTGCAAGTGGACTGTGAAATGTATGGGCTTACTA
ATGACCACTACAGTATTACACTAAGACGATATGCTGGAATGGCTTTGACAAACTTGACTT
TTGGAGATGTAGCCAACAAG
gtatgtttttataacatgtatttcttaagatagctcaggtatgagttaatttactttcat
acaaatacattttactgattttcttttttttcactctcctcattaaacaatgactgataa
aaacctgtgcttcacattcgcttatctttactcatttgtttgtcttatgcctaaacaaag

Exon 13 +      81281      81495   0   Internal    215    68    Marginal
tataaatactatttggtattttatgaacatttttctaaatggaaagttcttaatttacca
gtgagggacgggcaataggatagattaaaaaatagcttttattcaatatcagtaacatag
aagttaatgagagacaaattccaactctaattagatgacccatattctgtttcttactag
GAATCAACCCTCAAAAGCGTATTGAGTGCCTTATGGAATTTGTCAGCACATTGCACTGAG
AATAAAGCTGATATATGTGCTGTAGATGGTGCACTTGCATTTTTGGTTGGCACTCTTACT
TACCGGAGCCAGACAAACACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGGAAT
GTGTCCAGCTTGATAGCTACAAATGAGGACCACAG
gtatatatagagttttatattacttttaaagtacagaattcatactctcaaaaagaccta
attgtaagcaatgttttatataatcatgaaagttttaagccaaaatatatttattactgt
gaaaagataactactaactcttagtttaactcattagtgtacttaatgtaataacagttt

Exon 14 +      83309      83398   2   Internal     90    90   Excellent
caagtgattctcctggctcagcctcctgagtagctgggactacaggcatgcactaccatg
cccggctaatttttgtatttttagtagagacagggtttcaccatgttggccaggctggtc
ttgatctcctaatctcaggtgatccgcctgcctcagcctcctaaagtgctgggattacag
GCATGAGCCACTGTGTCTGGCCAAGAGCACTCGTAAGAAGGATGGCAGTATCACAAAATC
AAGCCAGAGATACAGAGATTACTCTAAAAA
gtaagtgttctaatctaagagcttataatgtgcactgactgcagaaaaatcttcaatcaa
ttctatctacctcttccaagataactcaatatcaatatcagagtggcacccaaccataga
ttaaattaccacaaagttcctattcaacataggatttcatgatatagtttttaaattggg

--------------------------------------------------------------------------------