Gene WHSC1 Variant 9
DNA : 40.51 KbNT_037623
mRNA : 3601 bp NM_133336
CDS : 1755 bp NP_579891
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  498 bp
aaggaaaacaaaaccctggggaggagagtggcaatggctctgtttttcttgttttgcatg
aggtgcttgactggcttttaaaaatcagttaaacagactttaaaaaaaaaaaaagacatg
agcaattggacatttgaacgctagctgatgatataagagcattgttacttttaagtgtgg
GAGTAGCATTGTGGTTATATGTAAGACTTTATGTTTAGAGATTTGTGCTAAACTTCTTAT
GGATGAAATGATATGTCTGGGATTTGCTTCAGAATAATCTGGCAGGGGGACGTGGAACCA
GGTATGGATAGAGCCACGCTGGCCCCAGGTTGATGTTTTTGGGGGCCAAGTAGCGAGGAC
ATGGGGTTCATTGTACAGTTTGTCTGCTTTTGTTTATGTTCAGATTTTTCCATGATAGAA
AGTTAAGCCAGAAGGACAAAGGAATTCAGAAGATTCATCTTTAGAACTTCACTTATTTGA
GGGGTAATTTTTAAGCAGTAAAAAGATCAAGGGTTTATGATTTGAAACTTTACAAACCAA
AATTATTTTACAGCAACGAAAAATCTGTCTGATGCATGTAAACCACTGAAGAAGCGAAAT
CGGGCTTCCACGGCAGCATCTTCAGCTCTTGGGTTTAGCAAAAGTTCATCTCCTTCTGCA
TCCTTAACTGAGAATGAG
gtaaaataataataataacgataaccatggcattggtatgaaggccatttagctgcccac
gctgcagtgtgagtaatgctcagacttcataagcgcagcattggtgctcactgccagtgc
agatgttttagggcctcttggctaactcagattcatgaaatggacaaacagtgcactatg
EXON 2  132 bp
gttatattatcacaaaaaccagttgatgatggttccactgtgaaatcactggcggtacag
gaccagtgctgagaaagactggtgggtggtggggtggggcgggacgagcctgcctgcagg
gcatggccacccgctgtgttctgcgactagtgaactgtcatccgcctccttcatctctag
GTCTCGGACAGCCCGGGAGACGAGCCCTCGGAGTCCCCATACGAAAGTGCAGACGAAACA
CAAACTGAAGTATCTGTCTCATCCAAAAAGTCTGAGCGAGGAGTGACTGCCAAAAAGGAG
TATGTGTGCCAG
gtgaggagaaggcagcatccgctatgtccgtgctggtgtctgactggggccccggtacgc
agagcgaatttgtagtgtcttttcccttcccaccagaccccttccccaatctcaccgtca
ctcactcatctctgttttgaaggggtcagactgactctcagtggaatcctgggattgagt
EXON 3  124 bp
tgattctgtatttgtacgttctgtttgggccagacgtttgcccatgcatgttattatata
tccttgagtagcaaaatgggattttctgccactggagacagaagcagacggcttcccttg
tggtaagaggtgcagaagggactgccgggcgctgcttacccgcctgctctgcccccgcag
CTGTGTGAGAAGCCGGGCAGCCTCCTGCTCTGTGAAGGACCCTGCTGCGGAGCTTTCCAC
CTCGCCTGCCTTGGGCTTTCCCGGAGGCCAGAAGGGAGGTTCACCTGCAGCGAGTGTGCC
TCAG
gcaagttcccacgggcgggcagctctgcagcctggccggccacctgctcctgcaaccccc
tgcaccaagtcctgccctgagctgcctgcagaggacaagccccctccccacccccaccgc
ctggccctctctggagcttgtagcccacagctggcaggtgtacccacctctcagtagctg
EXON 4  201 bp
tggctggatctttttgctggagaatgcttggactagtgagcaaggttggaaacagggcca
ggtgctttagcagcatggctgcctctgaagaggagttgcttgattttagtggctcagaac
tgcaatttaattcttgttctttgcacctctctctccaccccttctttaactttttgttag
GGATTCACTCATGTTTCGTGTGTAAAGAGAGCAAGACAGATGTTAAGCGCTGTGTGGTAA
CTCAGTGTGGAAAATTTTACCATGAGGCTTGTGTGAAAAAATACCCTCTGACTGTATTTG
AGAGCCGAGGTTTCCGCTGCCCCCTCCACAGCTGTGTGAGCTGCCATGCTTCCAACCCTT
CAAACCCAAGGCCGTCAAAAG
gtacaggtgcacctgcgcagccttgctgtgggttcagatgcaggccagacgcaggcccat
gggcgcttgggaaggtgggctgttgggattgtcaccaaagagcattaattatcttgagtg
actaactggacatcggctgggttgggttttctttgacaaaggacctgtctcccttttcct
EXON 5  180 bp
ttttctcaaacatggttttgaagcacctttgctctgaaagctttttttaaatcaaatacc
tccatttcattttagcattaacttttcaaattcatggaggctgagtaattattagttgct
cttttcactatgactggagtcagtgtttggggtccttagggtgtgtttctttgccttcag
GTAAAATGATGCGGTGTGTCCGCTGCCCCGTTGCCTATCACAGCGGGGATGCTTGTCTGG
CAGCAGGATGCTCAGTGATCGCCTCCAACAGCATCATCTGCACTGCCCACTTCACTGCTC
GGAAGGGGAAGCGACACCACGCCCACGTCAACGTGAGCTGGTGCTTCGTGTGCTCCAAAG

gtgaggggcctgggggtgtctgcggcacacgcctctcacactcccaggagccacatatca
aggcaggctcattccttgtctgcgctgtgttcattgatgttgacagtgttctgtgcgtct
tcacgttaatagtatatcacagtagctctaaattaattgtaatcatttcgcaaacataca
EXON 6  157 bp
aacatacaggaaattatttgtggtgaaaatgacatttgctctcgtgctgatgtacagatc
gctgttttaaaactgatgtttataagttaaggctgtaataagtgtagactgtgaagcact
gaatctgggctgagccatagcagacaggctaagcctggccgcctcgccctcctcttgcag
GGGGGAGCCTTCTGTGCTGTGAGTCCTGCCCAGCGGCCTTCCACCCTGACTGCCTGAACA
TCGAGATGCCTGACGGCAGCTGGTTCTGCAATGACTGCAGGGCTGGGAAGAAGCTGCACT
TCCAGGATATCATTTGGGTGAAACTTGGGAACTACAG
gtgtgagacatagaatcgtatgcttttatgtcttttctgttcacatgtgttcgctttaca
gtacttaaagtattgaaattattatcgctgtctctgaggagtctgtgaatcctgttttta
atatttataatagatggtggccggcagaagtttgccatcccaaaaatgttcccccaaata
EXON 7  206 bp
aagctgcacttccaggatatcatttgggtgaaacttgggaactacaggtgtgagacatag
aatcgtatgcttttatgtcttttctgttcacatgtgttcgctttacagtacttaaagtat
tgaaattattatcgctgtctctgaggagtctgtgaatcctgtttttaatatttataatag
ATGGTGGCCGGCAGAAGTTTGCCATCCCAAAAATGTTCCCCCAAATATTCAGAAAATGAA
GCACGAGATTGGAGAATTCCCTGTGTTTTTCTTTGGGTCTAAAGATTATTACTGGACGCA
TCAGGCGCGAGTGTTCCCGTACATGGAGGGGGACCGGGGCAGCCGCTACCAGGGGGTCAG
AGGGATCGGAAGAGTCTTCAAAAACG
gtacggagatattcagatagagagtgagacagcactctcgtgcattttcttacccctaat
ttctattttttaaaatttgatctttatagaaaatactggactaagcattcaatctgtttt
tttaaattaggaaaatgtttgcagtctggtttatttgttgagcatagaataagatacact
EXON 8  104 bp
cacacttggccgcatttaaaaatacctgcccactgacagttgttcatagactctagtttt
atgggaaccagaaactatacttaacattgaaagtttagagtgaactataaaaatatggag
cttgaaaggtagttacctgtatttactaaaatctttactcctatttcattgactttttag
CACTGCAAGAAGCTGAAGCTCGTTTTCGTGAAATTAAGCTTCAGAGGGAAGCCCGAGAAA
CACAGGAGAGCGAGCGCAAGCCCCCACCATACAAGCACATCAAG
gtggcgtgtgggagctgcgtgcacgcgtgtggagggagtcttccccgagggccgtgagag
gttcttaggcacacccaggctatggctggggagaggactgtcaccagccaggatctgtgg
tgcctggcatggatggccacacaagagaccatgagcaaatggcatggggggatctgcatg
EXON 9  270 bp
gcagaggagagctcctctgggatctggggagggctgttctgagtagtgtgtcctagccag
gactctgaagctttctaaaaggccacctggaggctgggtaaggagaggcagtggtgggtg
tgcaagggtattcggaaggctctcatgtgtggaccaagacagcttactccttccctgcag
GTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAG
TGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGG
ATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAG
TGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGG
GGCCTGGTCGCCAAGAGGGACATCAGAAAG
gtatgtgtcgttatcccctcccctgcttttgagaaattacggttcactgggtaattaggc
ctaggtttgcttgtggtggttttgtagtcatgtgagaatggtattttttggaaaaaaaat
tttttttgtttttgttttgagacagggtctcactctgtcatctaggctggagggcagtgg
EXON 10  117 bp
atacagatatgtctgagatcctttgaatttaatttatggagactttgtacacgccctcca
cggaggtatgctgatgtgtgtggtgcccgttctaagtgatcatgatggggagtcttgagc
cccgacactgaggattggtcagcacgctttttgtcatggccacatgcttgtgatttccag
GGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGA
ATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAG
gtaatgcggaactccactgtgagcttctgcagtgtgctggacctggagccctgatggtca
cctgtagaactggactttgccctgtggcagcgccagcatttgtctccttagctgcttatt
ttcaaacatctgcacattttcttctgaggtgcagcgtgtctttcagctgcgccggagggc
EXON 11  142 bp
tgtgagcaagagaaacaggactggtttgggggtgtcctgtctcagtggacacaggacacc
acggttttcagtacaacaaggaacacaacttgttcaatgtgctttatgatggtgaaaatt
ccctttaaaaataacatgcgattgctaacacttgaccgaatatatcacttgaccttacag
GACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGC
CAGCCCAACTGTGAGACCCTCAAGTGGACAGTGAATGGGGACACTCGTGTGGGCCTGTTT
GCCGTCTGTGACATTCCTGCAG
gtacaagctctggggaccctgcatggggctcctggctatgggggcagagtggccatcgct
gagggctgcgtggggctggactggaaaggctctgggggaggtgggtgctgatgtggagtc
tcttttggtttgaatatctcttttaccaagcaaaattgaaaggccatgggtcaagccagt
EXON 12  107 bp
gatgtggagtctcttttggtttgaatatctcttttaccaagcaaaattgaaaggccatgg
gtcaagccagtacagatacaaaaataataagagtatttttgttgacctaatacacgcccc
ttagcttttgaagagaaaggcaggtgtttccaatttggtgtctgtctcctcttctcccag
GGACGGAGCTGACTTTTAACTACAACCTCGATTGTCTGGGCAATGAAAAAACGGTCTGCC
GGTGTGGAGCCTCCAATTGCAGTGGATTCCTCGGGGATAGACCAAAG
gtaaggctgtggcgccctccttccccccaggctctgtgttggcattttgcactcctggag
acctgtgtcccccgtgaacagcggcttcctccaggctggcttgttgccgggacaggtggg
agcaagttccctgctgtgggctggggaggatggctctcaacaaaggccagtggttaagag
EXON 13  205 bp
tgagtcgagtgagtctaaggatgtctggggagcacgaggaggacactcctctcctctcct
cttagtgttgggcacctgcagagatctctgaagttcctggagtgtagctcgctcttctgc
cctatttgcttcagcctgtgtaattctttccggtgatctgtgcttaattcttgactctag
ACCTCGACGACCCTTTCATCAGAGGAAAAGGGCAAAAAGACCAAGAAGAAAACGAGGCGG
CGCAGAGCAAAAGGGGAAGGGAAGAGGCAGTCAGAGGACGAGTGCTTCCGCTGCGGTGAT
GGCGGGCAGCTGGTGCTGTGTGACCGCAAGTTCTGCACCAAGGCCTACCACCTGTCCTGC
CTGGGCCTTGGCAAGCGGCCCTTCG
gtgggtgtgcagcctcgcggtggcttgcagctgtgtctgtgtggcaggctcctgatggcg
gctgctgccgctcttcctgctgaccgggcctcatctgggtgcaggcacatcaggcgctca
tgcagcgaaggccctgatccagggtggcagagcctttctttgttccaccagccgcacatt
EXON 14  1158 bp
ggccctgccagggagcccgcccgggctgtggtagacagtttgtctgcccgtcctgttcgc
tggagccagcactattttgtgttcatttgacctgacagttgtaagtcatcttcaaccacg
ataatgttgaagtcgtgattccatcacttctgtgtgctcacatcttgtgttctgttgcag
GGAAGTGGGAATGTCCTTGGCATCATTGTGACGTGTGTGGCAAACCTTCGACTTCATTTT
GCCACCTCTGCCCCAATTCGTTCTGTAAGGAGCACCAGGACGGGACAGCCTTCAGCTGCA
CCCCGGACGGGCGGTCCTACTGCTGTGAGCATGACTTAGGGGCGGCATCGGTCAGAAGCA
CCAAGACTGAGAAGCCCCCCCCAGAGCCAGGGAAGCCGAAGGGGAAGAGGCGGCGGCGGA
GGGGCTGGCGGAGAGTCACAGAGGGCAAATAGCGCCAGGCGGCCGCTTGGCCGGATCCAG
GGGCGGTGCAGGGCGGCCGGCCCTGCCTGCGGGAGAGGGCGAGCATGAACTGGCCCGGAG
GACCCAGCTCGAGCCGCCAGGACACAGACGTACAGGCCTCCTCGGGAGGGAGCGCCTCCC
CACCACTGAGCCATCCTCAGCAGCGTCCGCTGCGTCTGCACTGATGACCGTCTGAGCCCA
GCTCAGCGTTCCTGGACAAACAGCCTCACTCCTCAGCGTTACCGCCACACTTGAATTTCT
CCGAATGTCAAGGTTCCCTCCCACTCTATTTTTTTAGGTTAAAGTTAATTGGCATATGGA
ATGTTTTAATCTCCTCTGAAATGTGTAGCGTAGGCTTTTCCCAAGGGTCGCTAGAAACTC
GTCTTCGCGTTGCCCCCTTTCTGGCTCTCAGCGCCGTCGCCACTCGGGAGAGGCTGGGTG
AGGCCCGTGTGAGGACTGACCCTGGATTCCTCGAAACTGCCATTGTGATCATTACTCTGC
TCTTTGGAAATGGCTGTATCATTTTTTTGTACTAATGTGAATTGTTCCTCAGAAACGCTT
CTTTTCCATCCTAGTGAGAAGCTGGCCCTGCAGGTGGTGGCAGCAATGGTGTTGTAAGAT
TTCCTCCCGTAGTTTTTTCTCCTCATGGATTTGAATGAAATGCCAATAACACGTCCACTT
TCAACGTGTAGTTTACGCGGAGCACTTTCGAGGCCTGGCCGGGTTGGGCCTACTTCTCAC
CTGGGCCTATCTTCTGAACTCGCTAGGTTCTTATCAACATTTGGGGGATAACTTTGTATA
TTTTTTTCATTTGGCTTTTCTTTACCAGTTTCTGATTTTTATTCTCAATATATTTTTGCT
AAACCTATTTCACAAATC
accaccgactgaagtgtgtgtttactgatgcggccctgagctccatggcgaaaggagtga
ctttgcagggcgtgagaccgcagtctgcttagagcacaggaagtgacaacttagggagcc
ccgtagggcgctgcaggccccggggaccccagcacgtgggtctaaagagagacggagtct