Gene WHSC1 Variant 7
DNA : 48.19 KbNT_037623
mRNA : 8390 bp NM_133334
CDS : 1944 bp NP_579889
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  626 bp
attccgtgtaatttttgtgatactaaaactgccttctgtgacctgaattattataaaaac
atcataaattgcttacaaagaaaatcagaccccacaaagctgtagaggtcctggcatacc
tatcctaggttttaaatgtaattgctttttctttcttttttcttttttttaataccatag
TGTTCTAAGAACGGAAGCATCTGGGCTGGATGGAATTTAGCATCAAGCAGAGTCCCCTTT
CTGTTCAGAGTGTTGTAAAGTGCATAAAGATGAAGCAGGCACCAGAAATCCTCGGCAGTG
CCAACGGGAAGACTCCGAGCTGCGAGGTGAACCGCGAGTGTTCTGTGTTCCTCAGCAAAG
CCCAGCTCTCCAGTAGCCTGCAGGAGGGGGTCATGCAGAAGTTTAACGGCCACGACGCCC
TGCCCTTTATTCCAGCCGACAAGCTGAAAGATCTTACTTCCCGGGTGTTTAATGGAGAAC
CCGGCGCACACGATGCCAAACTGCGTTTTGAGTCCCAGGAAATGAAAGGGATTGGGACAC
CCCCTAACACTACCCCTATCAAAAATGGCTCTCCAGAAATTAAGCTGAAAATCACCAAAA
CATACATGAATGGGAAGCCTCTCTTTGAATCTTCCATTTGTGGTGACAGTGCTGCTGATG
TGTCTCAGTCAGAAGAAAATGGACAAAAACCAGAAAACAAGGCGAGAAGGAACAGGAAGA
GGAGCATAAAATATGACTCCTTGCTGGAGCAGGGCCTTGTCGAAGCAGCTCTTGTGTCTA
AGATCTCAAGTCCTTCAGATAAAAAG
gtatttaggagacgttgtgtaaggggtcatgtgaccttgagcagtgagcatggccaccct
atgagggcacctgcacgagtactggggcgggcggagaaggtgaggacaggcctggtactt
ccagccacttgcctgagccctggctttgggttggagggtgggctccaggatgccctggca
EXON 2  163 bp
agagacaaaattttgatgaaacgatgttgaggctatcatctaaaacacagcaagggagca
cactccatttttgggggtctgtgtgtatttggacattgtagcctggtgaatccttggtct
tctggatacacaggtagtgattggatgtgttagtgtttgtcttctgttgttcattttcag
ATTCCAGCTAAGAAAGAGTCTTGTCCAAACACTGGAAGAGACAAAGACCACCTGTTGAAA
TACAACGTTGGTGATTTGGTGTGGTCCAAAGTGTCGGGTTACCCTTGGTGGCCTTGCATG
GTTTCTGCAGATCCACTCCTTCACAGCTATACCAAACTTAAAG
gtattgtgttctttgggttgtttttccaactttctcttctgcacttaatctttctcatct
ccaggcttctttcttactctttctaaatagccctgctatggttcatttttgcagctttac
ctaaagttagtgattgattcaagtgtgatgtgttgccatttctttttatattcaactcaa
EXON 3  167 bp
taagttaattagtttccctctttggcatgtggcatggaagggataagaagtatagaattt
gttttgaggttaacaggctcagacaacaccaagggaaacaactgcaaaatagcagtagat
ttgactagtttcatcccagattctaactttcattctctaacattttattttaaaaactag
GTCAGAAAAAGAGTGCACGCCAGTATCACGTACAGTTCTTTGGTGACGCCCCAGAAAGAG
CTTGGATATTTGAGAAGAGCCTCGTAGCTTTTGAAGGAGAAGGACAGTTTGAAAAATTAT
GCCAGGAAAGTGCCAAGCAGGCACCCACGAAAGCTGAGAAAATTAAG
gtgatagatgacccttcagtctacttttagaccagaaatttaatttttattctttaagtt
aacttatttttgttttgaacttatacttgctcgaaatattgtaatggcttaacaatctct
ttcattgttgacttttgcccaaggatgccatgttacaatatgataaagttcttttagaga
EXON 4  483 bp
agtagagatggggttttgccatgttgaccaggctggtcttaaactcctggcctcaagtga
tccatctgccttgacacccataagtgctggaattataggcatgaatcatgtgcctaggaa
aagtagttaacttttatgtttgtgtagtgaaacttacagtgtctcttttttttttcccag
CTATTGAAACCAATTTCAGGGAAATTGAGGGCCCAGTGGGAAATGGGCATTGTTCAAGCA
GAAGAAGCTGCAAGCATGTCAGTGGAGGAGCGGAAAGCCAAGTTCACCTTTCTCTATGTG
GGGGACCAGCTTCATCTCAACCCTCAAGTAGCCAAGGAGGCTGGCATTGCTGCAGAGTCT
TTGGGAGAAATGGCAGAATCCTCAGGAGTCAGTGAAGAAGCTGCTGAAAACCCCAAGTCT
GTGAGAGAAGAGTGCATTCCCATGAAGAGAAGGCGGAGGGCCAAACTGTGTAGCTCTGCA
GAGACCCTGGAGAGTCACCCCGACATAGGGAAGAGTACTCCTCAAAAGACGGCAGAGGCT
GACCCCAGAAGAGGAGTAGGGTCTCCTCCTGGGAGGAAGAAGACCACAGTCTCCATGCCA
CGAAGCAGGAAGGGAGATGCAGCATCCCAGTTTTTGGTCTTCTGTCAAAAACACAGGGAT
GAG
gtcagtactaagttgtgtttcatgctagcaagtttcagaatttgaggaacatcccttcag
tgcagaatcatctgtttctcagcattatcaggagactctaacatgagccttgcatagatt
ttagatctaataaataagtattagggaacagccattctgacccttgagggaaaagatact
EXON 5  145 bp
gtcacagcatcagttaagcactacttttctttgaagcttttatggacatagttccacgat
gtgggaataaaaatgcgacacactaagttctaaagggccgtgcatttgatttcatgcaaa
acaaaacccaatgagttttacggatttaacttctcattgcaccttctcccgttcccacag
GTGGTAGCTGAGCACCCAGATGCTTCAGGTGAGGAGATTGAAGAGCTGCTCAGGTCACAG
TGGAGTCTGCTGAGTGAGAAGCAGAGAGCACGCTACAACACCAAGTTTGCCCTGGTGGCC
CCTGTCCAGGCTGAAGAAGACTCTG
gtaaacatagcattatgctgatgtcctctgcttgggttgatgtgtgtagtgtagcaagct
gagctctgatcttggaaccgtagggaagtgtgtccactctccctgtttctgacccgtggg
gtttgggccagcggtccaagtgcgtgtggtcacagtaaaaacagcttctgccatctgcgt
EXON 6  119 bp
gtttttttgttgtaaagagatttgatctgtaagacataagccctggaaatcagcagggtt
acaggaaacccatcatgggctggatctgtatgttgaatgccctgggtaggttctcacagt
gcttcaaatgcagcttttggagtggttttcatgtacattttccccattccccattccaag
GTAATGTAAATGGGAAAAAAAGAAACCACACAAAGAGGATACAGGACCCTACAGAAGATG
CTGAAGCTGAGGACACACCCAGGAAAAGACTCAGGACGGACAAGCACAGTCTTCGGAAG
gtaattgtgttccaggtttgcttgacctgtcagagtgtatgctctgtgactcttggtgcc
actgtttccctgcatgggagcacacatgagatgcaggtgtcagtgcacccagctccttcc
aggctggtattcagcagaaggcttgcatttcttacagaaccccattgagaaaggctgctt
EXON 7  82 bp
acacatttccaaaggaagaagtttctgccacgaaacttttcagcaacctgtgttcattca
catgaggagattttttttcctttcttttccttttgttgttctttttctttttttttcctt
tttttcttttcttttttttttctttctttttttttttttttttttttttttaaataatag
AGAGACACAATCACTGACAAAACGGCCAGAACAAGCTCTTACAAGGCCATGGAGGCAGCC
TCCTCGCTCAAGAGCCAGGCAG
gtaatgtggtcagcgccctttccttcttggcttctgggtgcccaggctgggctgggtggg
tgggctgagagtgtgaaaggggaaggctggggctggtgaaggggaacagggcaggggagg
aatccacaattaagctaggagtgaaaaagaaggaaaggaggttctcctgtggttgaaaac
EXON 8  125 bp
tacagtttgtctgcttttgtttatgttcagatttttccatgatagaaagttaagccagaa
ggacaaaggaattcagaagattcatctttagaacttcacttatttgaggggtaattttta
agcagtaaaaagatcaagggtttatgatttgaaactttacaaaccaaaattattttacag
CAACGAAAAATCTGTCTGATGCATGTAAACCACTGAAGAAGCGAAATCGGGCTTCCACGG
CAGCATCTTCAGCTCTTGGGTTTAGCAAAAGTTCATCTCCTTCTGCATCCTTAACTGAGA
ATGAG
gtaaaataataataataacgataaccatggcattggtatgaaggccatttagctgcccac
gctgcagtgtgagtaatgctcagacttcataagcgcagcattggtgctcactgccagtgc
agatgttttagggcctcttggctaactcagattcatgaaatggacaaacagtgcactatg
EXON 9  6480 bp
ttttattggaataattattacatggtactacatcaccctgaggaagagaataaattaaaa
ttacacacttgcatgacaaaggcctgtgaaggaattaatgtgatttaagtgttttgtaac
ttcattttttattcctttagtagagcaaattcttatttttttcgccttcactggtaacag
CTTTTGTGGGAGCCCACACCAGTCAAGTTGGATTTGAACCCAGCTGCTCTGTACTGCACT
TAGAATGATGTAATATTCCAGGATGCTGCTGCAGGTGGCGTATCATCGTACACACTCAGT
GACATTTCTATCACAATCATTTTATGGAAGATGTGTGATAATCTGTTTTTACTGGTATTA
ATAAACACATACAATGAAGAAAACAGATAACAAATTTTAAGACCAAGGTAAGATAACTAA
TCAAGGCCATTTAATCCGTCACATTCATCTCATAATAGAAACACGTTCATATTCCAGTGG
TCAATGTAGATTTCAAGTTGAAAGGCAGTCCCTTTAGTTGGGGGCTGTCCAGAGCTGCAG
CAGGGCTTTGCACGGAAGGGGTGGCCCTGTTAGAGTTGCTTCTCCTCTAGTTTGTAACTT
ACTGGACTTTTGTGGAAAATATCAGCGTCGCTACCCTCAGAAACAAACTAACAGCACACG
TTAGGAGGAGTCCTCATCAGCTGTTCTCATTGCCAGTGAGATATATTCAGTATTGTAGAT
ACTACACTAATTTCCAACATAAGAGGCAGGAAGAGTTTTGATTCTATCCTTTTTTACTAA
ACAGTTTTATTATGACACTAGATACAGTAAATTTTTAGAAAAAAATACCATTTACAGTAT
TATTGTGAACCATTTAACCCTTTTGATCCAAGGCCCCGGACCAAGGGGATACTGTAATCA
GGTTATGTACACCAACCTCTGCATCAGTTGCTTCTATAGAGCATCAGCCCTCATGTTTCA
TTGTCTTAATGTCGGGGAGCAGCCTGGTGTCCTGCCCCAGGTGTCCGCATTTTTGCATGG
TAAGGAAAAGGCTTACTTGCCCTTCAGCTCATAAAAGCAGAAGGTGTGCTATTCACAGTA
CCATGCGAGTAGCCCACAGTTAATTCCCGGCAGATTCTTTGGCTGTGTTTTATCTTTAAT
GAACGTTTCTGACTAATATTTTGTTGTAAACCATTAAGTAATGTAACGCATGTAAGATGC
TTAGGGTGCCTGGCCAGGACTCCGTGGTTTCCTGTTGTGACAGTAATAATGGTTATAATA
ATAAAAATGATAAAATTGCCATCATTCTATTTTTATCCAAAAGTATAAATTTTGCTTTGG
CATGAAAAGTGGTCCTCTTGACTGCATTATGCATGCGAGGATGAAATAAACCTAGAAGTG
GCAGAACACTGGATTTGTGTGTGTGGCGCTTTAGGGTGCTGGACTGTATGGCTGAGGGCT
GGTTGGGTTCCTCTATTGGCTCTGCTCAAATGTTGCAGGATACATAGCCCCAAAGATGGT
CTAGGAGCAATCTAAGCTGTGTTACTCCAAAGGACATGAAAAAGCTCAAGAGTAAAATTA
AAATTCTCAAAAAAAAACCCCACGAAATTTAAAGATGGGGAAAAAAAGATGGTATAAAAA
TGGCTCTGGTTCAATAAGCAGTCACCCAAAGTAAAGACTCTATCTTGAAAGGCTTTTGGT
GAAAATGAAGGGATTTCATTTGAAATTACAGCATGATGAATTTTGCATGGGTGGCCAGCC
AGCTAGCCCATAACTGATAGATGCATTAGAAGTCAGCCAGCGCATAGGTGCTCCCTCTAT
ATTATGGAGAAAGCAAAACCCTGCAAATGACCAAATGGTGTCCAAAGAGCAGCATGACAT
TGGCATCAGCTGAATAACCAGGGGCACATGGGGGAACGTGGATGGGAATGATAGTGTATC
TCAGCGGGGGGTGGGGTGACATCGTTCCCTGGGGACATTGGGAAGGTGGGCAGGGGCAAG
TGAACTCAGCACTCTGCAGTGAGAGGGACAGTCCCATGTGTGGCAGCATTGTCCCACTTC
AGATGCCAGGAGTGGGCTCATCCTAGAGGAGCGGAGTTTTCCGAGAGGACCATCTCCTGG
TTTCCTGAAGGAGGTGGGTGGAAACGGCTCTTGTTTGAAAGAACTTAGGGAGGACCATTG
GCTTGCCAAGAGTACAGAAATTCATTATGCTGCTAATTTAACGTGGAATTCCTTCATTTC
ATAAGAACCTCAAAATAATGGTGATACATTCTAGCCTTAAGACATTTGAATTGCCGGTTG
TTGAGGTGAATTTTGTTTGTCATACATGGAACCATTTTAGTCCCATTTGACTCACTTCAG
ACCATCTTCCACACACTATGTCTGTGCTTGGAGAGGGGAGGTGGCTCTCCAGTGTAAAAC
TTGAGGCATTCACTAGAGGTGAAAACTTGTCAGAATATATAAAAGCTTAGATTGTAGCTG
TTCTAAAAACGTAAGTACTCCATTGTAATAGGGTGGCATCTTCAGGTAGTGCACATATTG
GCAATAGAGGTCCTGAATTGTTTTTCTAAGACTGATCTGAGAGCCATTGGGCCATCAAGC
CTTTATATATCTGCTTCTAAAATTGCCCCACCTGCTCTAGATGGATCTTTGGGCCTTTCC
TCAGTGTTCATGCAAAAATTAAATGTCTTTTTTCAGCATACTGACTCCAGGTGTAGTTAC
ATCTCAGTGCTGTCTTGAGTATATATTTTATCTCTTATACCTGTATCTCCCAACTAGAAA
CAGCTCCAGTGTTTTTAAGAGAATGTTTCTTAAAACCAATAGGAAACTTAAGCGAGGTTT
CATGACACAACCTTTCATGTCGTGAAAGGCAGAGGGTGACTGTGTGTGATGTGCAGAGTC
CTTGGACAGGAGTCGGGGGCTCCTCTGTCCCACTGCTGCTTCTTGAGTGGGTGGAGTGGT
GCTTAGAGGATCTCCGAGAGGTCCCCGCAGCTCTAGGGAGATCTGATTTTGTGTTTTTTG
TTTAAGTACTTCACACAGAAGCCTAGGTAGATTTAAAATGGGGTGCTCAGGGACTGGGGA
ACAAGACGGGGTGGGGTGGGGAGATGGGCATTTGGAGAGTCTCATGTAGCTGGAGACGTT
AAGAGCTGAGCACACCACAGGAAAGGAGGGAGGATGCTGTGTGAGAGCCATGCTGTCAGG
AGCAAGCTTGCTGCTCCTGTGCTGCCCTGGCCCTGGCCTTGCTTGCCCATGGTGTGTGTG
TCCAGAGGTGTGTGTGAGGCTGCCAGAACAAGTGCTGGGTCTGTCACAGAGAAGTTTAAA
AAAGAAAACTAAGATTATAAATTAGCATCTAGTTCCAAAACCAAAAAAAGTGCCTGTGGA
TGTATATAAAATTAAGATGATAAGAAAGTGCTCCTGAGAAGGCTCTTGCCAGAAGCCTGA
TGTGAGTGTGTGGCACCTGTGATGGCAGGGCTGTGAGCTGGGCTTCTGTCCTCCTCTGTG
TCCCGGCATGGAAGCCAGTATAAGCATTTCCAAATGAGGGAAAAGTCCTTGGCTCGTTTG
ATCCAGTTGAGTTGAAAGGGTTGCCTTGGCAGCAGAGGCTCCTCTGATGGCTGACATCAG
TCACTGCGTCTGGGCCTGAGACGTGCATGGAGGGCTGTAAAGCCACGGATTCCCCTCGCT
GGAGAGGCTCCTGTCTGATAGCGGTAGATGAAAAATAAGGTCGTTATGACTTTGGCAACT
TGCTTCATTTCTTTTTCATTTGACTTACAACACACTTCTCTAACATCTAGCCCTTTTAAA
TTTTTAATTAATTTCAAAGCTTCCTCTGGCCAGGTAGACTTTTGTATACAGACCAGGTGA
GAGCCCTTTTGCCTTAGTGTGAAAATGTAACATTTTATGCTTTTAAAATCAATAGATTCA
TCACCTTAGTTTTTTAAAAAAAATCTATAAATAGGGTAATTGCTGAGGTGTGCGGTTTAT
CTTTGAGATGATAAAGCTAAATTATAGTCTTTTGCCAGAGAAACTGAGGTAACTGTCATT
AGAAAAGGTTTCTTAAAATACTCACAAAGCTGTTATTGGCTTCTTAACTTCTAAAATTTG
GGGGGTCTTGCATTTATTTATTATTTATTTATTTATTTATTTAGAGACAGAGTCTCACCC
TGTTGGCCAGGCTGGAGTGCAGTAAGTGGCACAATCTCGGCTCACTGCAACCTCCGCCTC
CTTGGTTCCAGCAATTCTTCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAAGCGGCTGC
CACCACACCTGGCTATTTTTTTTTGTATTTTTAGTAGAGACAGGGTTTCGCCATATTGGC
CAGGCTGGTCTTGAACTCCTGACCTCGTGATCCACCCGCCTCACCCTCCCAAAATGCTGG
GATTACAGGCGTAAGCCACTGCACCTGGCGGGGTCTTGCTTATTTTAAAAGAAATATTCT
GATTCATATTTTAGGACTTTTTGTCAACGAAATTGGTTTTGATCCCTTTGGGTACCATTT
TTATTGTTTTATGTAGAATGTTAGAAATTACCACTAATTTACCTGGCAGTGATGTCAAAT
TGACTGTAATTAGCAGGTAGAAAATTATTTGTATTATATTCATCTGATTCCTATACTGGA
TGAGCAAGGAGCATGCTTCCTTTGGGACATTCTTACAGCAGGGTGTCTCTCCAACAGCCC
GACAGGCCTCATCTTTTTGGTTGGATACCTTTGAACTCCATGGTTACGTGTTAGGTCCAC
ATTTGTGTTTTTTTCTAGCCTACCTATAGTTGTTGGCCTTTTTGCATATAACTCTCGGGT
AATATTTTGAAGCATGCTGACCATCCAGGCATATAGTATTTTCAAGAAATGACTGAGGTA
GGGGTGGGGGTCCTGGTCCGGCTGATGGGGGTTTGCTCAGCACTGTGCCAGTGGAAGCAG
GTGTATTGTGGGCAGTTTTGTCATTGTCCTCAAGTCCTTCGCAGACAGTGCACAGCCTGC
TGTCTGCAGTCGGCCAGACCAGGCTCCTCCCCAGCACACTCCCTGTGGGATGGCCGCTGC
TCAGGACACAGTGGGACAAAGTTGGGTTGATAGGATATTTTAGATTCATTTTACCTTTGA
CAAGGGCAGGCCTTGAATTGGGAGCAGCAGCCACCTGGCCTCACTCTGGCCACAGGTGAC
ACTTGGTCCTTGCTGCCACCTGCTTGGGGCTATGTGGCTACGGCTACACAAAAGCCTGTG
CAGGTTAGAAGACGACTGTGGTGTGCAGTGGTGCTCTGGGAGTGGAGACTTCCTCTGTTC
TCAGAGACTCACCCCCAGCCCTGACCCTAGAATTTAGGGATAGCCAGGAAGTTTCTAGTT
TGTGTAACCTAGAAGGGTCACTTTAATAAAAATTGTTATGAACTATAGTATTTTAGATGA
TGAGTGACTTATTTTAATTCCACTTTAACATTTTACTGTGCTGTTAACTTGGAAGACCTG
TTTGAAATTAGTCTTGATTTCACACTCATTTAATCTGCTGAGCACAGGGCTGTTGTCATT
TGTAAACGCAAACACTGTGGAGGTACTTCTCGCCATCAGCTTCCTTCTTTACAAAACCAT
CATTTCAACATGAAAATTATGTCAGTTTATAGAAATATTTATTGTTCAAGGTCTGTAATT
GTATTTCAAAAACGATGTCGTATTCAAGTTGTGAAGGGATTTGTTTTGTCAAAAAATTAA
AAACTCAATGTGTATGACGCCACTCTGAAGAGTAGGTGAGCGCTTTGCAGTCACAGAAGG
TGGCATCTGACTGCGGCTCATACAGGTCACCCTGAAGGGCCACGTGCTTTTAGCAGTTGG
CTGGAATGTGTTCACTAGGTTCCGTTATGTTTGGTAATATCATCTTGAAAAGTCCCTGTA
ATAGATCAAGGAGACTGCATTCCCTGCCCTGAAGGAATGTATTTCTAAGGCAAATAGGCA
ACTTGGTACTATCTTATTCTGAGTAGAGAGTGGAGAAAGTATTTTCAGACTGAAGAAAAC
TTTGAAAAGTCAGGAGCTAAGCTGCTCGGAGCTCAGTGCCGCAGCATGGCTGTGGTGGAC
GCGGGAAACAACGGGAAAGTTCTTGACAGAGTCTGTGTCCGCTCAGTCCCTGCACTTTTC
CTTTCCAAATGCATCTCGTTGGATATGGAATAGATCGTAGATGTTGTAGACTGAGATTTG
GGACTATGTTGGGACCGTACAGGTGAATGTGCCACCTCCACAAATGGCTTCTCCGAGTGA
GTCACGTCACCTGGTGCGTGGAGGTGGAGCCTGCGGCTGGAGTAAGGCTTGCTGTGGGAC
GCCCTCGTACTTTGCTCTCCTTGCGGGTGGTTGCCGAGCCGAGAGCATTGGATCCTCCCC
GACTGTGGCTAGTTGTCTGTCCGGTGGCTGGGAGGGGGTGTGGTGGGAAAAAGTCGGAAT
CTCTGCAATCTGTGTCATGGACTGTACTATTGTAAGGTCTATATTCTGTATGTGGGTCCC
AGACCCTGATCAGGAAATGAGCCTCATGTGTGTCGTTAACATTTATATATTTCCATTCAA
AATATGTATTCAGTGTTTATTTCCTCAAAACAGACTTTGTTAATGTAGGAAATCTCTCCA
AGTGGAAACGTGCTAACTTTTTCTGTAAATCTGAAATAAAAGGTGCTGTTCCTTCCTCTG

acccaggactgctttgtgttttctgtctttctctccatgcattttttttctcatttttaa
agctttttaagtttgttccaccacgttaagggaagagcatgggttggtggatagcgctgg
ggctctctcccctgagccatgcagaaggcccctttctctgggccttggttcccccatcag