Gene WHSC1 Variant 6
DNA : 82.98 KbNT_037623
mRNA : 7597 bp NM_133331
CDS : 4098 bp NP_579878
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  176 bp
tatgagctggaagaggaactgactttgatctacctttttaagaaattgtgcgggtcagac
agaacacatttgtatgtgttttggtgttaaagagttgtccagagcacatgaagctgaact
gggacttcaacattttttcaaggttttacatttgctctttttttcctgtctccttcctca
GCTGTCTGCTTTTCTGTGGAGACTGCGGGTTGCAGACACCAGCAGCCCCCTATTGCTGCA
CGTCAGGTGTCCTCCACCTCAGTACTGTGGACATCTCGGGCCGCATAGCCCTGTTGCGCG
GGCATCCTGTGCGTTGCAGGAGATGCAGCAGCATCCATGACCGCAACCCATCAGAG
gtcagggtccgccccctagtggtggtaataaaaaatgcttccagatgaggttaagtgtcc
ctggggaacaaaatcctccccatttgagaaccgctgttctagtccacgggcatctctggt
ccttactgtactcagattttccctagtgtctgatgctattgatttctggcttctcagagg
EXON 2  626 bp
attccgtgtaatttttgtgatactaaaactgccttctgtgacctgaattattataaaaac
atcataaattgcttacaaagaaaatcagaccccacaaagctgtagaggtcctggcatacc
tatcctaggttttaaatgtaattgctttttctttcttttttcttttttttaataccatag
TGTTCTAAGAACGGAAGCATCTGGGCTGGATGGAATTTAGCATCAAGCAGAGTCCCCTTT
CTGTTCAGAGTGTTGTAAAGTGCATAAAGATGAAGCAGGCACCAGAAATCCTCGGCAGTG
CCAACGGGAAGACTCCGAGCTGCGAGGTGAACCGCGAGTGTTCTGTGTTCCTCAGCAAAG
CCCAGCTCTCCAGTAGCCTGCAGGAGGGGGTCATGCAGAAGTTTAACGGCCACGACGCCC
TGCCCTTTATTCCAGCCGACAAGCTGAAAGATCTTACTTCCCGGGTGTTTAATGGAGAAC
CCGGCGCACACGATGCCAAACTGCGTTTTGAGTCCCAGGAAATGAAAGGGATTGGGACAC
CCCCTAACACTACCCCTATCAAAAATGGCTCTCCAGAAATTAAGCTGAAAATCACCAAAA
CATACATGAATGGGAAGCCTCTCTTTGAATCTTCCATTTGTGGTGACAGTGCTGCTGATG
TGTCTCAGTCAGAAGAAAATGGACAAAAACCAGAAAACAAGGCGAGAAGGAACAGGAAGA
GGAGCATAAAATATGACTCCTTGCTGGAGCAGGGCCTTGTCGAAGCAGCTCTTGTGTCTA
AGATCTCAAGTCCTTCAGATAAAAAG
gtatttaggagacgttgtgtaaggggtcatgtgaccttgagcagtgagcatggccaccct
atgagggcacctgcacgagtactggggcgggcggagaaggtgaggacaggcctggtactt
ccagccacttgcctgagccctggctttgggttggagggtgggctccaggatgccctggca
EXON 3  163 bp
agagacaaaattttgatgaaacgatgttgaggctatcatctaaaacacagcaagggagca
cactccatttttgggggtctgtgtgtatttggacattgtagcctggtgaatccttggtct
tctggatacacaggtagtgattggatgtgttagtgtttgtcttctgttgttcattttcag
ATTCCAGCTAAGAAAGAGTCTTGTCCAAACACTGGAAGAGACAAAGACCACCTGTTGAAA
TACAACGTTGGTGATTTGGTGTGGTCCAAAGTGTCGGGTTACCCTTGGTGGCCTTGCATG
GTTTCTGCAGATCCACTCCTTCACAGCTATACCAAACTTAAAG
gtattgtgttctttgggttgtttttccaactttctcttctgcacttaatctttctcatct
ccaggcttctttcttactctttctaaatagccctgctatggttcatttttgcagctttac
ctaaagttagtgattgattcaagtgtgatgtgttgccatttctttttatattcaactcaa
EXON 4  167 bp
taagttaattagtttccctctttggcatgtggcatggaagggataagaagtatagaattt
gttttgaggttaacaggctcagacaacaccaagggaaacaactgcaaaatagcagtagat
ttgactagtttcatcccagattctaactttcattctctaacattttattttaaaaactag
GTCAGAAAAAGAGTGCACGCCAGTATCACGTACAGTTCTTTGGTGACGCCCCAGAAAGAG
CTTGGATATTTGAGAAGAGCCTCGTAGCTTTTGAAGGAGAAGGACAGTTTGAAAAATTAT
GCCAGGAAAGTGCCAAGCAGGCACCCACGAAAGCTGAGAAAATTAAG
gtgatagatgacccttcagtctacttttagaccagaaatttaatttttattctttaagtt
aacttatttttgttttgaacttatacttgctcgaaatattgtaatggcttaacaatctct
ttcattgttgacttttgcccaaggatgccatgttacaatatgataaagttcttttagaga
EXON 5  483 bp
agtagagatggggttttgccatgttgaccaggctggtcttaaactcctggcctcaagtga
tccatctgccttgacacccataagtgctggaattataggcatgaatcatgtgcctaggaa
aagtagttaacttttatgtttgtgtagtgaaacttacagtgtctcttttttttttcccag
CTATTGAAACCAATTTCAGGGAAATTGAGGGCCCAGTGGGAAATGGGCATTGTTCAAGCA
GAAGAAGCTGCAAGCATGTCAGTGGAGGAGCGGAAAGCCAAGTTCACCTTTCTCTATGTG
GGGGACCAGCTTCATCTCAACCCTCAAGTAGCCAAGGAGGCTGGCATTGCTGCAGAGTCT
TTGGGAGAAATGGCAGAATCCTCAGGAGTCAGTGAAGAAGCTGCTGAAAACCCCAAGTCT
GTGAGAGAAGAGTGCATTCCCATGAAGAGAAGGCGGAGGGCCAAACTGTGTAGCTCTGCA
GAGACCCTGGAGAGTCACCCCGACATAGGGAAGAGTACTCCTCAAAAGACGGCAGAGGCT
GACCCCAGAAGAGGAGTAGGGTCTCCTCCTGGGAGGAAGAAGACCACAGTCTCCATGCCA
CGAAGCAGGAAGGGAGATGCAGCATCCCAGTTTTTGGTCTTCTGTCAAAAACACAGGGAT
GAG
gtcagtactaagttgtgtttcatgctagcaagtttcagaatttgaggaacatcccttcag
tgcagaatcatctgtttctcagcattatcaggagactctaacatgagccttgcatagatt
ttagatctaataaataagtattagggaacagccattctgacccttgagggaaaagatact
EXON 6  145 bp
gtcacagcatcagttaagcactacttttctttgaagcttttatggacatagttccacgat
gtgggaataaaaatgcgacacactaagttctaaagggccgtgcatttgatttcatgcaaa
acaaaacccaatgagttttacggatttaacttctcattgcaccttctcccgttcccacag
GTGGTAGCTGAGCACCCAGATGCTTCAGGTGAGGAGATTGAAGAGCTGCTCAGGTCACAG
TGGAGTCTGCTGAGTGAGAAGCAGAGAGCACGCTACAACACCAAGTTTGCCCTGGTGGCC
CCTGTCCAGGCTGAAGAAGACTCTG
gtaaacatagcattatgctgatgtcctctgcttgggttgatgtgtgtagtgtagcaagct
gagctctgatcttggaaccgtagggaagtgtgtccactctccctgtttctgacccgtggg
gtttgggccagcggtccaagtgcgtgtggtcacagtaaaaacagcttctgccatctgcgt
EXON 7  119 bp
gtttttttgttgtaaagagatttgatctgtaagacataagccctggaaatcagcagggtt
acaggaaacccatcatgggctggatctgtatgttgaatgccctgggtaggttctcacagt
gcttcaaatgcagcttttggagtggttttcatgtacattttccccattccccattccaag
GTAATGTAAATGGGAAAAAAAGAAACCACACAAAGAGGATACAGGACCCTACAGAAGATG
CTGAAGCTGAGGACACACCCAGGAAAAGACTCAGGACGGACAAGCACAGTCTTCGGAAG
gtaattgtgttccaggtttgcttgacctgtcagagtgtatgctctgtgactcttggtgcc
actgtttccctgcatgggagcacacatgagatgcaggtgtcagtgcacccagctccttcc
aggctggtattcagcagaaggcttgcatttcttacagaaccccattgagaaaggctgctt
EXON 8  82 bp
acacatttccaaaggaagaagtttctgccacgaaacttttcagcaacctgtgttcattca
catgaggagattttttttcctttcttttccttttgttgttctttttctttttttttcctt
tttttcttttcttttttttttctttctttttttttttttttttttttttttaaataatag
AGAGACACAATCACTGACAAAACGGCCAGAACAAGCTCTTACAAGGCCATGGAGGCAGCC
TCCTCGCTCAAGAGCCAGGCAG
gtaatgtggtcagcgccctttccttcttggcttctgggtgcccaggctgggctgggtggg
tgggctgagagtgtgaaaggggaaggctggggctggtgaaggggaacagggcaggggagg
aatccacaattaagctaggagtgaaaaagaaggaaaggaggttctcctgtggttgaaaac
EXON 9  125 bp
tacagtttgtctgcttttgtttatgttcagatttttccatgatagaaagttaagccagaa
ggacaaaggaattcagaagattcatctttagaacttcacttatttgaggggtaattttta
agcagtaaaaagatcaagggtttatgatttgaaactttacaaaccaaaattattttacag
CAACGAAAAATCTGTCTGATGCATGTAAACCACTGAAGAAGCGAAATCGGGCTTCCACGG
CAGCATCTTCAGCTCTTGGGTTTAGCAAAAGTTCATCTCCTTCTGCATCCTTAACTGAGA
ATGAG
gtaaaataataataataacgataaccatggcattggtatgaaggccatttagctgcccac
gctgcagtgtgagtaatgctcagacttcataagcgcagcattggtgctcactgccagtgc
agatgttttagggcctcttggctaactcagattcatgaaatggacaaacagtgcactatg
EXON 10  132 bp
gttatattatcacaaaaaccagttgatgatggttccactgtgaaatcactggcggtacag
gaccagtgctgagaaagactggtgggtggtggggtggggcgggacgagcctgcctgcagg
gcatggccacccgctgtgttctgcgactagtgaactgtcatccgcctccttcatctctag
GTCTCGGACAGCCCGGGAGACGAGCCCTCGGAGTCCCCATACGAAAGTGCAGACGAAACA
CAAACTGAAGTATCTGTCTCATCCAAAAAGTCTGAGCGAGGAGTGACTGCCAAAAAGGAG
TATGTGTGCCAG
gtgaggagaaggcagcatccgctatgtccgtgctggtgtctgactggggccccggtacgc
agagcgaatttgtagtgtcttttcccttcccaccagaccccttccccaatctcaccgtca
ctcactcatctctgttttgaaggggtcagactgactctcagtggaatcctgggattgagt
EXON 11  124 bp
tgattctgtatttgtacgttctgtttgggccagacgtttgcccatgcatgttattatata
tccttgagtagcaaaatgggattttctgccactggagacagaagcagacggcttcccttg
tggtaagaggtgcagaagggactgccgggcgctgcttacccgcctgctctgcccccgcag
CTGTGTGAGAAGCCGGGCAGCCTCCTGCTCTGTGAAGGACCCTGCTGCGGAGCTTTCCAC
CTCGCCTGCCTTGGGCTTTCCCGGAGGCCAGAAGGGAGGTTCACCTGCAGCGAGTGTGCC
TCAG
gcaagttcccacgggcgggcagctctgcagcctggccggccacctgctcctgcaaccccc
tgcaccaagtcctgccctgagctgcctgcagaggacaagccccctccccacccccaccgc
ctggccctctctggagcttgtagcccacagctggcaggtgtacccacctctcagtagctg
EXON 12  201 bp
tggctggatctttttgctggagaatgcttggactagtgagcaaggttggaaacagggcca
ggtgctttagcagcatggctgcctctgaagaggagttgcttgattttagtggctcagaac
tgcaatttaattcttgttctttgcacctctctctccaccccttctttaactttttgttag
GGATTCACTCATGTTTCGTGTGTAAAGAGAGCAAGACAGATGTTAAGCGCTGTGTGGTAA
CTCAGTGTGGAAAATTTTACCATGAGGCTTGTGTGAAAAAATACCCTCTGACTGTATTTG
AGAGCCGAGGTTTCCGCTGCCCCCTCCACAGCTGTGTGAGCTGCCATGCTTCCAACCCTT
CAAACCCAAGGCCGTCAAAAG
gtacaggtgcacctgcgcagccttgctgtgggttcagatgcaggccagacgcaggcccat
gggcgcttgggaaggtgggctgttgggattgtcaccaaagagcattaattatcttgagtg
actaactggacatcggctgggttgggttttctttgacaaaggacctgtctcccttttcct
EXON 13  180 bp
ttttctcaaacatggttttgaagcacctttgctctgaaagctttttttaaatcaaatacc
tccatttcattttagcattaacttttcaaattcatggaggctgagtaattattagttgct
cttttcactatgactggagtcagtgtttggggtccttagggtgtgtttctttgccttcag
GTAAAATGATGCGGTGTGTCCGCTGCCCCGTTGCCTATCACAGCGGGGATGCTTGTCTGG
CAGCAGGATGCTCAGTGATCGCCTCCAACAGCATCATCTGCACTGCCCACTTCACTGCTC
GGAAGGGGAAGCGACACCACGCCCACGTCAACGTGAGCTGGTGCTTCGTGTGCTCCAAAG

gtgaggggcctgggggtgtctgcggcacacgcctctcacactcccaggagccacatatca
aggcaggctcattccttgtctgcgctgtgttcattgatgttgacagtgttctgtgcgtct
tcacgttaatagtatatcacagtagctctaaattaattgtaatcatttcgcaaacataca
EXON 14  157 bp
aacatacaggaaattatttgtggtgaaaatgacatttgctctcgtgctgatgtacagatc
gctgttttaaaactgatgtttataagttaaggctgtaataagtgtagactgtgaagcact
gaatctgggctgagccatagcagacaggctaagcctggccgcctcgccctcctcttgcag
GGGGGAGCCTTCTGTGCTGTGAGTCCTGCCCAGCGGCCTTCCACCCTGACTGCCTGAACA
TCGAGATGCCTGACGGCAGCTGGTTCTGCAATGACTGCAGGGCTGGGAAGAAGCTGCACT
TCCAGGATATCATTTGGGTGAAACTTGGGAACTACAG
gtgtgagacatagaatcgtatgcttttatgtcttttctgttcacatgtgttcgctttaca
gtacttaaagtattgaaattattatcgctgtctctgaggagtctgtgaatcctgttttta
atatttataatagatggtggccggcagaagtttgccatcccaaaaatgttcccccaaata
EXON 15  206 bp
aagctgcacttccaggatatcatttgggtgaaacttgggaactacaggtgtgagacatag
aatcgtatgcttttatgtcttttctgttcacatgtgttcgctttacagtacttaaagtat
tgaaattattatcgctgtctctgaggagtctgtgaatcctgtttttaatatttataatag
ATGGTGGCCGGCAGAAGTTTGCCATCCCAAAAATGTTCCCCCAAATATTCAGAAAATGAA
GCACGAGATTGGAGAATTCCCTGTGTTTTTCTTTGGGTCTAAAGATTATTACTGGACGCA
TCAGGCGCGAGTGTTCCCGTACATGGAGGGGGACCGGGGCAGCCGCTACCAGGGGGTCAG
AGGGATCGGAAGAGTCTTCAAAAACG
gtacggagatattcagatagagagtgagacagcactctcgtgcattttcttacccctaat
ttctattttttaaaatttgatctttatagaaaatactggactaagcattcaatctgtttt
tttaaattaggaaaatgtttgcagtctggtttatttgttgagcatagaataagatacact
EXON 16  104 bp
cacacttggccgcatttaaaaatacctgcccactgacagttgttcatagactctagtttt
atgggaaccagaaactatacttaacattgaaagtttagagtgaactataaaaatatggag
cttgaaaggtagttacctgtatttactaaaatctttactcctatttcattgactttttag
CACTGCAAGAAGCTGAAGCTCGTTTTCGTGAAATTAAGCTTCAGAGGGAAGCCCGAGAAA
CACAGGAGAGCGAGCGCAAGCCCCCACCATACAAGCACATCAAG
gtggcgtgtgggagctgcgtgcacgcgtgtggagggagtcttccccgagggccgtgagag
gttcttaggcacacccaggctatggctggggagaggactgtcaccagccaggatctgtgg
tgcctggcatggatggccacacaagagaccatgagcaaatggcatggggggatctgcatg
EXON 17  270 bp
gcagaggagagctcctctgggatctggggagggctgttctgagtagtgtgtcctagccag
gactctgaagctttctaaaaggccacctggaggctgggtaaggagaggcagtggtgggtg
tgcaagggtattcggaaggctctcatgtgtggaccaagacagcttactccttccctgcag
GTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAG
TGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGG
ATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAG
TGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGG
GGCCTGGTCGCCAAGAGGGACATCAGAAAG
gtatgtgtcgttatcccctcccctgcttttgagaaattacggttcactgggtaattaggc
ctaggtttgcttgtggtggttttgtagtcatgtgagaatggtattttttggaaaaaaaat
tttttttgtttttgttttgagacagggtctcactctgtcatctaggctggagggcagtgg
EXON 18  117 bp
atacagatatgtctgagatcctttgaatttaatttatggagactttgtacacgccctcca
cggaggtatgctgatgtgtgtggtgcccgttctaagtgatcatgatggggagtcttgagc
cccgacactgaggattggtcagcacgctttttgtcatggccacatgcttgtgatttccag
GGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGA
ATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAG
gtaatgcggaactccactgtgagcttctgcagtgtgctggacctggagccctgatggtca
cctgtagaactggactttgccctgtggcagcgccagcatttgtctccttagctgcttatt
ttcaaacatctgcacattttcttctgaggtgcagcgtgtctttcagctgcgccggagggc
EXON 19  142 bp
tgtgagcaagagaaacaggactggtttgggggtgtcctgtctcagtggacacaggacacc
acggttttcagtacaacaaggaacacaacttgttcaatgtgctttatgatggtgaaaatt
ccctttaaaaataacatgcgattgctaacacttgaccgaatatatcacttgaccttacag
GACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGC
CAGCCCAACTGTGAGACCCTCAAGTGGACAGTGAATGGGGACACTCGTGTGGGCCTGTTT
GCCGTCTGTGACATTCCTGCAG
gtacaagctctggggaccctgcatggggctcctggctatgggggcagagtggccatcgct
gagggctgcgtggggctggactggaaaggctctgggggaggtgggtgctgatgtggagtc
tcttttggtttgaatatctcttttaccaagcaaaattgaaaggccatgggtcaagccagt
EXON 20  107 bp
gatgtggagtctcttttggtttgaatatctcttttaccaagcaaaattgaaaggccatgg
gtcaagccagtacagatacaaaaataataagagtatttttgttgacctaatacacgcccc
ttagcttttgaagagaaaggcaggtgtttccaatttggtgtctgtctcctcttctcccag
GGACGGAGCTGACTTTTAACTACAACCTCGATTGTCTGGGCAATGAAAAAACGGTCTGCC
GGTGTGGAGCCTCCAATTGCAGTGGATTCCTCGGGGATAGACCAAAG
gtaaggctgtggcgccctccttccccccaggctctgtgttggcattttgcactcctggag
acctgtgtcccccgtgaacagcggcttcctccaggctggcttgttgccgggacaggtggg
agcaagttccctgctgtgggctggggaggatggctctcaacaaaggccagtggttaagag
EXON 21  205 bp
tgagtcgagtgagtctaaggatgtctggggagcacgaggaggacactcctctcctctcct
cttagtgttgggcacctgcagagatctctgaagttcctggagtgtagctcgctcttctgc
cctatttgcttcagcctgtgtaattctttccggtgatctgtgcttaattcttgactctag
ACCTCGACGACCCTTTCATCAGAGGAAAAGGGCAAAAAGACCAAGAAGAAAACGAGGCGG
CGCAGAGCAAAAGGGGAAGGGAAGAGGCAGTCAGAGGACGAGTGCTTCCGCTGCGGTGAT
GGCGGGCAGCTGGTGCTGTGTGACCGCAAGTTCTGCACCAAGGCCTACCACCTGTCCTGC
CTGGGCCTTGGCAAGCGGCCCTTCG
gtgggtgtgcagcctcgcggtggcttgcagctgtgtctgtgtggcaggctcctgatggcg
gctgctgccgctcttcctgctgaccgggcctcatctgggtgcaggcacatcaggcgctca
tgcagcgaaggccctgatccagggtggcagagcctttctttgttccaccagccgcacatt
EXON 22  3566 bp
ggccctgccagggagcccgcccgggctgtggtagacagtttgtctgcccgtcctgttcgc
tggagccagcactattttgtgttcatttgacctgacagttgtaagtcatcttcaaccacg
ataatgttgaagtcgtgattccatcacttctgtgtgctcacatcttgtgttctgttgcag
GGAAGTGGGAATGTCCTTGGCATCATTGTGACGTGTGTGGCAAACCTTCGACTTCATTTT
GCCACCTCTGCCCCAATTCGTTCTGTAAGGAGCACCAGGACGGGACAGCCTTCAGCTGCA
CCCCGGACGGGCGGTCCTACTGCTGTGAGCATGACTTAGGGGCGGCATCGGTCAGAAGCA
CCAAGACTGAGAAGCCCCCCCCAGAGCCAGGGAAGCCGAAGGGGAAGAGGCGGCGGCGGA
GGGGCTGGCGGAGAGTCACAGAGGGCAAATAGCGCCAGGCGGCCGCTTGGCCGGATCCAG
GGGCGGTGCAGGGCGGCCGGCCCTGCCTGCGGGAGAGGGCGAGCATGAACTGGCCCGGAG
GACCCAGCTCGAGCCGCCAGGACACAGACGTACAGGCCTCCTCGGGAGGGAGCGCCTCCC
CACCACTGAGCCATCCTCAGCAGCGTCCGCTGCGTCTGCACTGATGACCGTCTGAGCCCA
GCTCAGCGTTCCTGGACAAACAGCCTCACTCCTCAGCGTTACCGCCACACTTGAATTTCT
CCGAATGTCAAGGTTCCCTCCCACTCTATTTTTTTAGGTTAAAGTTAATTGGCATATGGA
ATGTTTTAATCTCCTCTGAAATGTGTAGCGTAGGCTTTTCCCAAGGGTCGCTAGAAACTC
GTCTTCGCGTTGCCCCCTTTCTGGCTCTCAGCGCCGTCGCCACTCGGGAGAGGCTGGGTG
AGGCCCGTGTGAGGACTGACCCTGGATTCCTCGAAACTGCCATTGTGATCATTACTCTGC
TCTTTGGAAATGGCTGTATCATTTTTTTGTACTAATGTGAATTGTTCCTCAGAAACGCTT
CTTTTCCATCCTAGTGAGAAGCTGGCCCTGCAGGTGGTGGCAGCAATGGTGTTGTAAGAT
TTCCTCCCGTAGTTTTTTCTCCTCATGGATTTGAATGAAATGCCAATAACACGTCCACTT
TCAACGTGTAGTTTACGCGGAGCACTTTCGAGGCCTGGCCGGGTTGGGCCTACTTCTCAC
CTGGGCCTATCTTCTGAACTCGCTAGGTTCTTATCAACATTTGGGGGATAACTTTGTATA
TTTTTTTCATTTGGCTTTTCTTTACCAGTTTCTGATTTTTATTCTCAATATATTTTTGCT
AAACCTATTTCACAAATCACCACCGACTGAAGTGTGTGTTTACTGATGCGGCCCTGAGCT
CCATGGCGAAAGGAGTGACTTTGCAGGGCGTGAGACCGCAGTCTGCTTAGAGCACAGGAA
GTGACAACTTAGGGAGCCCCGTAGGGCGCTGCAGGCCCCGGGGACCCCAGCACGTGGGTC
TAAAGAGAGACGGAGTCTAGCTCTCCTGCCACCCAGAGTGGCTTCCATCTCAGCACTCTG
TGGGTCTGGTGATGGAAGATGCAGTCTCTGCTGATCACATGTGCCCTCTGCCAGGGCACC
TACTGAGAGGTGCGGTCCTGGGGGTGGAGGCCTGCCTGGCAGGTGTGCGTGCCTCGTACG
TGTGTTATGGGCACTGGTCTAGGCCAGGTATGACACCCACTCTCCTGTGAGATTTCACTT
TAGTTTTTAAAAGGTCCAGTTCTACAGAGTGAGACCTATCTATCTGAGTACTACATATGT
TTTAAGACTTGGTTCTTTTTTTGAGGGATCCTTGACCCTGGGAAGTCTGGAGCACCCTGA
GAAGGGGGCACCATGTGTGCCTTTGCCCACGTGTCCTGAGGGGCTGCTTGTCTGGGAGGG
AGGGAGAGAACATTCAGCAGCAGGTGCTTTTTTATGGCCTTTTCTTAAAATAACCTAAGG
GGGACACATCCATCTTGCAGAGAAGTTTACAGAACTCCCCTTGAAAACTGCTGCTGAGGC
TCCTGTTAAATTTTCTGTGGCATCTTTTATGCCTTGGTAAAAACTGCAGTGTCTTTGGAC
CTGAGAGTGGCTACTCCGTGGTTTTGTGACCTGTAAGCGTGGGGTTCAGGGGTGTGTGGC
CCTGCAGGGTCCCACGCCTCCCTGAGCACTGACTGGAAGTTTCACTGGCTGGTGGCTGTC
CCTTCTCCCATCAGGGTCCCCAGCAAAGTTAACTACACAGAGGACCCAGGGGAAACGAGC
TGTGTAGCCACTGACTTGCTCGCGCGGCCGTGGCCTCTGAGGGGCACTCGCCGGTTAAGA
CAGGGTGGGAGTAGTGCTTTCCAGTTCAGACTCTAACTTCTCCCAAAGTGTCCTAAGAAA
ATACTGGATCGGCTCATAGATTTATGCTCCTTATGATGCCCTAACTTGGAAGGTTGTTCT
AGGGACAGGCCGGGCAGTGTCCCCACACACACCTTAGAGTCGAAGGCCCCAGGGCCCCGC
TGTCACTTGCCCAAAAGATCCCTTCCGGCAGGTAAGGGACTACCAATGCTTACGTCAAAA
CAGCAGAATCGGCTTTGCAGTGCACTTTGGGGAGCAGATATTAACTTATTTTTGTGTTGG
ACAGTAGTGAAATCTTGTGATTTTTAATCGCTTTGATAATACTTCCAAATTTTATGATTT
TTCTGAAGGAAATAATGCAAACATTTTAAATATGTTTCTCCCCCTTTCCAAAAACTGTTA
AACTAATGAGCAAGTAACACTAACTTTGAATGTCTCTACAATACCCGTTGATAACTCAGT
GGAGCCAGGCTTTGGGGTAGCGGCCCTGAGCTTGCAGGGTTTCTCGCCACTGGGGCTGAC
CACGCCCCCAGCTGTGACCGTGGGTGTGGCTGGCTCTCGGCCCTGCCCAGCTTTGTTCTG
AGGACGTGGTGACTTCCTGAACATCAGCTTCAATCCTCCATCATTAATGTGAAGCAAAAC
ACAAAAACCGCCCCAATCCCTCAGGATTCCTTGGCATCCGAAACCAGCATCTGCACCTAA
ACCCATACCCACCCGTGTGCGCCCACAGGGGGATGTGTCCGAATGGGCAGCTTAAAATGT
GGTCACCTGTGGGGGAAACTCTTCAGGCACCTGAAGTGAGAACCCAGCTGTCCGTCCTCA
GGCCGGCCTTTCTTCCGGCGACACCCGTCCATGGCTGGCTGGGTCCCCTTCGCAGTGTTT
GTCTGTCTTGACATCTAAACCCCGGCGTGTGCAGTGCCCATCTTCCAGGACTACCTTATT
TTCCAGAATTAAACCTGTTTTATAATTCAAGTTAATGCAAATGACTGTCAGTTGCCAAAT
ATCTTGATCCTATGAGTGTAGTTGATGACTGTTTGTTAGTCAGTAGAGTAAAATGCTGTG
TCCACGGGGTGTCACAGCCTCACCATACCCTGTTGAGGTGTGAAATGCCCCGTCAGAAAT
TAAATACAAACTTAAATGTGCCTATTGGTGTCTAAACTTCATACAATGTAAGGTCAGATT
CCTTTTAGGAATACTGGGTGCTGTCACCAGGTTTGATAGTTAGACTTAAAAACTTGAAAT
TCACTTTTTGGGGGGAGGGATATACTGAAATAGAGAGTTGAGACTTGCCAGTTGGGGGAA
AATAGCATTTAAAATGGAAAGCTGTGTTTGGAAAATTGTGTATGAGTATTTTTGTATTAA
AAACATTTTAAAGGCTTTTTTCTTAA
cttattttatatgggattgtttgattttttttccagttactttgaattgcaaagcatcgg
gtgtggcactgatgcctccgatgggtggggctccctgtcctgactgtgtcattttgcctt
tgacctgacccgctggggagaggcagtgccaccttgggaagtataacaacaaatactgga