Gene WHSC1 Variant 5
DNA : 48.85 KbNT_037623
mRNA : 5063 bp NM_007331
CDS : 4719 bp NP_015627
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  181 bp
tttttttttttgttttgttttgagacaaggtcttgctctgtaccccaggctggagtgcag
tggtgctttcttggctctctgcaatctctgctgcccaggctcaactgatcctcctgccac
agcctccccagtagctgggattatgggcatgcacccagctgatttttgtatttttttgca
GAGACAAGATTTCGCCATGTTGCCCAGGCTGGTCTCGAACTTCTGAGCTCAAGCGATCTA
CCTGCCTCGTCCTCCCAAAGTGTTGGAATTGCAGGTGTGAGCCACTGCACCCGGCCCTTG
CCTCATGTTTGAATGATAATTTACCTGGGCATAAAATTCTGGACACTTGTGGTGGCACGA
G
gtgggcatttattttcccttaatgcttgcttgattgattgacagacagtcttgctctgta
gcccaggctgcagtacagcggcatgcttataggttgctgtagcctcgaattcttaggctt
aagtgatcctcctccctcagcctctgaagaagctaggagtagcttctaggactagcttct
EXON 2  175 bp
atgagctggaagaggaactgactttgatctacctttttaagaaattgtgcgggtcagaca
gaacacatttgtatgtgttttggtgttaaagagttgtccagagcacatgaagctgaactg
ggacttcaacattttttcaaggttttacatttgctctttttttcctgtctccttcctcag
CTGTCTGCTTTTCTGTGGAGACTGCGGGTTGCAGACACCAGCAGCCCCCTATTGCTGCAC
GTCAGGTGTCCTCCACCTCAGTACTGTGGACATCTCGGGCCGCATAGCCCTGTTGCGCGG
GCATCCTGTGCGTTGCAGGAGATGCAGCAGCATCCATGACCGCAACCCATCAGAG
gtcagggtccgccccctagtggtggtaataaaaaatgcttccagatgaggttaagtgtcc
ctggggaacaaaatcctccccatttgagaaccgctgttctagtccacgggcatctctggt
ccttactgtactcagattttccctagtgtctgatgctattgatttctggcttctcagagg
EXON 3  626 bp
attccgtgtaatttttgtgatactaaaactgccttctgtgacctgaattattataaaaac
atcataaattgcttacaaagaaaatcagaccccacaaagctgtagaggtcctggcatacc
tatcctaggttttaaatgtaattgctttttctttcttttttcttttttttaataccatag
TGTTCTAAGAACGGAAGCATCTGGGCTGGATGGAATTTAGCATCAAGCAGAGTCCCCTTT
CTGTTCAGAGTGTTGTAAAGTGCATAAAGATGAAGCAGGCACCAGAAATCCTCGGCAGTG
CCAACGGGAAGACTCCGAGCTGCGAGGTGAACCGCGAGTGTTCTGTGTTCCTCAGCAAAG
CCCAGCTCTCCAGTAGCCTGCAGGAGGGGGTCATGCAGAAGTTTAACGGCCACGACGCCC
TGCCCTTTATTCCAGCCGACAAGCTGAAAGATCTTACTTCCCGGGTGTTTAATGGAGAAC
CCGGCGCACACGATGCCAAACTGCGTTTTGAGTCCCAGGAAATGAAAGGGATTGGGACAC
CCCCTAACACTACCCCTATCAAAAATGGCTCTCCAGAAATTAAGCTGAAAATCACCAAAA
CATACATGAATGGGAAGCCTCTCTTTGAATCTTCCATTTGTGGTGACAGTGCTGCTGATG
TGTCTCAGTCAGAAGAAAATGGACAAAAACCAGAAAACAAGGCGAGAAGGAACAGGAAGA
GGAGCATAAAATATGACTCCTTGCTGGAGCAGGGCCTTGTCGAAGCAGCTCTTGTGTCTA
AGATCTCAAGTCCTTCAGATAAAAAG
gtatttaggagacgttgtgtaaggggtcatgtgaccttgagcagtgagcatggccaccct
atgagggcacctgcacgagtactggggcgggcggagaaggtgaggacaggcctggtactt
ccagccacttgcctgagccctggctttgggttggagggtgggctccaggatgccctggca
EXON 4  163 bp
agagacaaaattttgatgaaacgatgttgaggctatcatctaaaacacagcaagggagca
cactccatttttgggggtctgtgtgtatttggacattgtagcctggtgaatccttggtct
tctggatacacaggtagtgattggatgtgttagtgtttgtcttctgttgttcattttcag
ATTCCAGCTAAGAAAGAGTCTTGTCCAAACACTGGAAGAGACAAAGACCACCTGTTGAAA
TACAACGTTGGTGATTTGGTGTGGTCCAAAGTGTCGGGTTACCCTTGGTGGCCTTGCATG
GTTTCTGCAGATCCACTCCTTCACAGCTATACCAAACTTAAAG
gtattgtgttctttgggttgtttttccaactttctcttctgcacttaatctttctcatct
ccaggcttctttcttactctttctaaatagccctgctatggttcatttttgcagctttac
ctaaagttagtgattgattcaagtgtgatgtgttgccatttctttttatattcaactcaa
EXON 5  167 bp
taagttaattagtttccctctttggcatgtggcatggaagggataagaagtatagaattt
gttttgaggttaacaggctcagacaacaccaagggaaacaactgcaaaatagcagtagat
ttgactagtttcatcccagattctaactttcattctctaacattttattttaaaaactag
GTCAGAAAAAGAGTGCACGCCAGTATCACGTACAGTTCTTTGGTGACGCCCCAGAAAGAG
CTTGGATATTTGAGAAGAGCCTCGTAGCTTTTGAAGGAGAAGGACAGTTTGAAAAATTAT
GCCAGGAAAGTGCCAAGCAGGCACCCACGAAAGCTGAGAAAATTAAG
gtgatagatgacccttcagtctacttttagaccagaaatttaatttttattctttaagtt
aacttatttttgttttgaacttatacttgctcgaaatattgtaatggcttaacaatctct
ttcattgttgacttttgcccaaggatgccatgttacaatatgataaagttcttttagaga
EXON 6  483 bp
agtagagatggggttttgccatgttgaccaggctggtcttaaactcctggcctcaagtga
tccatctgccttgacacccataagtgctggaattataggcatgaatcatgtgcctaggaa
aagtagttaacttttatgtttgtgtagtgaaacttacagtgtctcttttttttttcccag
CTATTGAAACCAATTTCAGGGAAATTGAGGGCCCAGTGGGAAATGGGCATTGTTCAAGCA
GAAGAAGCTGCAAGCATGTCAGTGGAGGAGCGGAAAGCCAAGTTCACCTTTCTCTATGTG
GGGGACCAGCTTCATCTCAACCCTCAAGTAGCCAAGGAGGCTGGCATTGCTGCAGAGTCT
TTGGGAGAAATGGCAGAATCCTCAGGAGTCAGTGAAGAAGCTGCTGAAAACCCCAAGTCT
GTGAGAGAAGAGTGCATTCCCATGAAGAGAAGGCGGAGGGCCAAACTGTGTAGCTCTGCA
GAGACCCTGGAGAGTCACCCCGACATAGGGAAGAGTACTCCTCAAAAGACGGCAGAGGCT
GACCCCAGAAGAGGAGTAGGGTCTCCTCCTGGGAGGAAGAAGACCACAGTCTCCATGCCA
CGAAGCAGGAAGGGAGATGCAGCATCCCAGTTTTTGGTCTTCTGTCAAAAACACAGGGAT
GAG
gtcagtactaagttgtgtttcatgctagcaagtttcagaatttgaggaacatcccttcag
tgcagaatcatctgtttctcagcattatcaggagactctaacatgagccttgcatagatt
ttagatctaataaataagtattagggaacagccattctgacccttgagggaaaagatact
EXON 7  145 bp
gtcacagcatcagttaagcactacttttctttgaagcttttatggacatagttccacgat
gtgggaataaaaatgcgacacactaagttctaaagggccgtgcatttgatttcatgcaaa
acaaaacccaatgagttttacggatttaacttctcattgcaccttctcccgttcccacag
GTGGTAGCTGAGCACCCAGATGCTTCAGGTGAGGAGATTGAAGAGCTGCTCAGGTCACAG
TGGAGTCTGCTGAGTGAGAAGCAGAGAGCACGCTACAACACCAAGTTTGCCCTGGTGGCC
CCTGTCCAGGCTGAAGAAGACTCTG
gtaaacatagcattatgctgatgtcctctgcttgggttgatgtgtgtagtgtagcaagct
gagctctgatcttggaaccgtagggaagtgtgtccactctccctgtttctgacccgtggg
gtttgggccagcggtccaagtgcgtgtggtcacagtaaaaacagcttctgccatctgcgt
EXON 8  119 bp
gtttttttgttgtaaagagatttgatctgtaagacataagccctggaaatcagcagggtt
acaggaaacccatcatgggctggatctgtatgttgaatgccctgggtaggttctcacagt
gcttcaaatgcagcttttggagtggttttcatgtacattttccccattccccattccaag
GTAATGTAAATGGGAAAAAAAGAAACCACACAAAGAGGATACAGGACCCTACAGAAGATG
CTGAAGCTGAGGACACACCCAGGAAAAGACTCAGGACGGACAAGCACAGTCTTCGGAAG
gtaattgtgttccaggtttgcttgacctgtcagagtgtatgctctgtgactcttggtgcc
actgtttccctgcatgggagcacacatgagatgcaggtgtcagtgcacccagctccttcc
aggctggtattcagcagaaggcttgcatttcttacagaaccccattgagaaaggctgctt
EXON 9  82 bp
acacatttccaaaggaagaagtttctgccacgaaacttttcagcaacctgtgttcattca
catgaggagattttttttcctttcttttccttttgttgttctttttctttttttttcctt
tttttcttttcttttttttttctttctttttttttttttttttttttttttaaataatag
AGAGACACAATCACTGACAAAACGGCCAGAACAAGCTCTTACAAGGCCATGGAGGCAGCC
TCCTCGCTCAAGAGCCAGGCAG
gtaatgtggtcagcgccctttccttcttggcttctgggtgcccaggctgggctgggtggg
tgggctgagagtgtgaaaggggaaggctggggctggtgaaggggaacagggcaggggagg
aatccacaattaagctaggagtgaaaaagaaggaaaggaggttctcctgtggttgaaaac
EXON 10  2922 bp
tacagtttgtctgcttttgtttatgttcagatttttccatgatagaaagttaagccagaa
ggacaaaggaattcagaagattcatctttagaacttcacttatttgaggggtaattttta
agcagtaaaaagatcaagggtttatgatttgaaactttacaaaccaaaattattttacag
CAACGAAAAATCTGTCTGATGCATGTAAACCACTGAAGAAGCGAAATCGGGCTTCCACGG
CAGCATCTTCAGCTCTTGGGTTTAGCAAAAGTTCATCTCCTTCTGCATCCTTAACTGAGA
ATGAGGTAAAATAATAATAATAACGATAACCATGGCATTGGTATGAAGGCCATTTAGCTG
CCCACGCTGCAGTGTGAGTAATGCTCAGACTTCATAAGCGCAGCATTGGTGCTCACTGCC
AGTGCAGATGTTTTAGGGCCTCTTGGCTAACTCAGATTCATGAAATGGACAAACAGTGCA
CTATGTTAGTTTATTTGAGCACTTTTTATACACACGCACACAGTGTCTGTGTACATGTAC
AGATATACTTCAGTCTTGATGCAGTTTCATAGTTCTTAAAATCTGTCTGAAGAATGTTGT
GTTCTGTGTAGCCCTCACACTGTAAGAGTTCACATGGAAGTAAGTCTGCGTTGGTTCTGA
AAGGGCACAGTGTCAGTTGAGCTGACATATACTGGGTGGGGTGGAAGGCGACTCACACAC
CACACCTGATTCCTGTTGCTTCCAGACCTAGGCTCATGGAGGAAGCCAAAGATTTCTTTG
TTCTCATGCATTTCATGGCTTTGGTCCTTTAAATTCTGGCACATTTTTAGTTACTTGAGT
GTTGAGGTGAGTCAGAACTACCATTGTAATATGACTCCTGTGTTCTGGACTTGCAGAGTA
CATGATAGCAAAATAAAGCCATTTGGGGCTGCTGCCTGCCATCATTGTAACATGACACTT
AGACTTTATTATCAAACCTAAATTTTTTGCCGTTGCCAAAAACAACAAATAGCCACAGAA
CGTAGGTGTGACACTTTTTTGTTCGGAGGTAGTTTTGGTTTCCTGATTTTTAGGGATTAC
CTTCATAGAGCTTTGGAGTTTTAATTTCTTGTTATTTGGTTCTCCGTGATGCTGTTTTTC
TCATTGTAGACATGGGTCCTGTTTTTGTCATGTTTATGAGGAGATGATAACTGGGGGCCC
TTTTGGAACAGGGTAGTGAGGCAAGGGTTGGACAGGCCCCTTACTCTTGCTGAGTCAGAA
GGCGGCACTTCTGGCCAGGTCTCTGCCATGGTCCCCAGGAAGGATGGGGTGTGCCTCAGT
TGTTTCCACTCATTAGAGGAGTGTAGGCCTTCCAGTGCAGGAAGGTCAGGGACCTAGGCA
ACCTGGGCGGGGCTCATAGAGCTCTGCGGCTTGCCACTCTGAATCCTCAGCGACCACTCC
TCCGAGTGGGATTTTCTGCAGGGACTCAAACCAACTCAGTGGTGGTCGAGACCTGTTCAC
GGATGGTGGGACTGGGGCTGCTTTACAGTTTGATACGTGTAGATAATTAAGCATTTTGTG
ATGTTTGGACACACTGGAGAAAAGGCAGTAAGAATTATTTACTGAAACATCTAGGAGCTT
ACTGAAATATGAAAAGGCAAATTTTATACAAATTATTTTTCCTTTTTCCTTTCTTTCTTG
TCCAAGTTCAGGTTAAAATCTTAGAAAATTAAATGAAAGGTCATTTACAGTTCCAAAGAA
GAATATTAAACATTTTTCACTTAAGTTGAGATTTTTGCTTTAAAGAGCTTTTAATGAGTT
TTTCTGTTATCATAATTTTGGTCCGGTTATTCACTTGAGTTGTTGCTTATACTGTTGTCA
GGTACAGTAGAGAGAACATGGAGCCTGCTGAGATCTTCTCTGTTATTCCTGATCCTAAGT
CATGTATATCGAAGGCTTTGATTTAGAGTAATGCATGAGGCCAGTGTAGCGGGGTCGAGG
CCTGCCCATGAGTCAGGGGAGCTCAGTCTCCCTGGCCTAGGCAGTTGTCCTGACCTTGAG
AAGACATAGATGAAGCATTTTATCATCATTAGACTTAAATTTTAATTCTTCAGAATGTCA
GAAGTTGATAGGTTGTTAAATACATTTATATAATACATTAAATATGTGAAATTAATACAC
CTTCCTACATTTTGAAGGTGATGCATAGATCCCATAGTGTGCATCATGTTCCTTATATGA
AAACGTTTAAATTACTGGGTCTTTTCCATTAAACTACTTTTGTATGGCTTAGATAAATCT
TCCATTAGTGTTCATTTTTATAGAATTATGCTGTTAAAACTACTTTAGGTGAACAAATAA
ACTTGTCTATTATATATTAACGCGACTGAACTACAGTAAATGTTTGTGATGTTTCCAATG
CTGAATGCCTGTTAGCATATGAGGCAAAGTGTAGTGTTATAAAAAACAGCCTGTTGACTG
CTGGGCCCGATTCTGATATGAGTTAGGTGACCATGAGAATTGCTGTTTGAGGTCCACACT
GACACACACCCATTGGGTCACACCCCCTTTGCATGTTTGTATTTCCTCCCTTTCATCACA
TTTGTTTGAAATAAGGTACTTTTATAGGGTTGGTATTTCAGAACACTTTAGGTCATGTTG
TAGTTTAAATTCTTCTTGAAAAAGGTATATGTGATAAATAAAAATTTTTATTGGAATAAT
TATTACATGGTACTACATCACCCTGAGGAAGAGAATAAATTAAAATTACACACTTGCATG
ACAAAGGCCTGTGAAGGAATTAATGTGATTTAAGTGTTTTGTAACTTCATTTTTTATTCC
TTTAGTAGAGCAAATTCTTATTTTTTTCGCCTTCACTGGTAACAGCTTTTGTGGGAGCCC
ACACCAGTCAAGTTGGATTTGAACCCAGCTGCTCTGTACTGCACTTAGAATGATGTAATA
TTCCAGGATGCTGCTGCAGGTGGCGTATCATCGTACACACTCAGTGACATTTCTATCACA
ATCATTTTATGGAAGATGTGTGATAATCTGTTTTTACTGGTATTAATAAACACATACAAT
GAAGAAAACAGATAACAAATTTTAAGACCAAGGTAAGATAAC
taatcaaggccatttaatccgtcacattcatctcataatagaaacacgttcatattccag
tggtcaatgtagatttcaagttgaaaggcagtccctttagttgggggctgtccagagctg
cagcagggctttgcacggaaggggtggccctgttagagttgcttctcctctagtttgtaa