Gene WDFY3 Variant 3
DNA : 88.14 KbNT_016354
mRNA : 3497 bp NM_178583
CDS : 2388 bp NP_848698
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  100 bp
aacagagtgtggcttccgggcatcagagcattttttaaaaagcttcttagttgattccag
tatccaaccaaggttgaaaagtcctcatgtatgagatagttagtggacctgggctacctg
tgttgaggaaaatattctgaattagagattaattcataacctttttccccctctttctag
CTGGAGCCCAGATTTCAAGTTTTGAGTAAAATACCTTCAAGCGAATGGGCCCTATTGTGC
TCACACATTCAGAACCTGTTACCCAAGGAATTCCCTAAAG
gtcagtctctgggaagaaaaattgtgggtttttgtttttaatctttactatcactggatt
tattgataaacaaagactgttaattatgtgtagacaggactttttatattgacttgattt
atagagctaccattataaatttgattactgtactatcatatttaggaaatagaaaatgta
EXON 2  211 bp
ttgcccttcagggggatttatcaaattttgcttctctgtcttttctgtttaaagaagtag
aaagatatattttagacagaattttctattttgcaaatttcttataagctcttacatgca
tgcttgacctagtcaagatgatgatgttttgactgttcatgtattgacattttcctacag
AATTAGAAGTGCGTCTCACCAACCAGCCAAGATGAACATGGTGAAGAGGATCATGGGGCG
GCCGAGGCAGGAGGAGTGCAGCCCACAAGACAACGCCTTAGGACTGATGCACCTCCGCCG
GCTCTTCACGGAGTTGTGCCATCCTCCCCGGCACATGACTCAGAAGGAACAAGAAGAGAA
ACTGTATATGATGCTGCCAGTGTTTAACAGG
gtaagtccaggttgccagacacacaccttccgggactggggggcactacaagaatctgaa
ggttactggtaagccataggtagaaaaaaatgataggctgagttagttttaagaagtttg
gtgttctcgtttcatgttttcaatttgctataaagcagtgtgacttgatgtgaaacctgg
EXON 3  124 bp
aatgtggctagacatgtgatttattgaaagcgttgtattttcaacatattaagattcaaa
gtaactgtgtaggtagacttttctggacttgattttcaagtcataccacacttgaaaatt
cacaaaataaaaagaaaaatttgtcagtgcttcattaacaatgtcttttcttatctacag
GTTTTTGGAAATGCTCCGCCGAATACAATGACAGAAAAATTTTCTGATCTTCTGCAGTTC
ACAACACAAGTCTCACGACTAATGGTGACAGAAATTCGAAGGAGAGCATCAAACAAATCC
ACAG
gtatttttacagtagccagcaaaaactgatttgtttgaatgaacaagcagttctgtaaaa
gtcccattaaaattaaatggaaaacagaccttgttctcagcacattgagttcatttaccc
attccctttccctttcttagagtcacattcttttcctggtttcagcatcttcaactctcc
EXON 4  110 bp
aatgatataaaggtttatgaataccattaaaacattgctatttttaaagtttttctatat
gtaatagtgctgatataattatgtgcttagtaaattttcatttccttggtaggttttaaa
gaagaacctctttatatgtgacttttcccccacttaatggctttccctttggttttatag
AGGCTGCAAGTCGGGCCATAGTTCAGTTCCTAGAGATTAATCAGAGTGAAGAAGCCAGTA
GAGGCTGGATGCTTCTAACGACAATTAATTTGTTAGCTTCCTCTGGTCAG
gtaagttcttagttttcatgtttgataactcagcgtctttattttatagcctctcttgtg
attttattattaaattcatcattatatccaaatgagatactatgataatcatttgtattc
ttctaacttttttaaaacattatttcatgcttctcataacatctctgcaaggagtttgat
EXON 5  162 bp
agcaaaattgttcagatgcatagttgtatatttcttcacttggagtcatttttaaattct
tacatgcattttaaaaagttacctttatatataatttttgggttaacatttgtgaattat
ttggctgtaccaattatagttgtgtctatctattcacttatttattggcttgttttccag
AAAACCGTGGACTGCATGACAACAATGTCAGTGCCTTCCACCCTGGTTAAATGTTTATAT
CTGTTTTTTGACCTTCCACATGTGCCTGAGGCAGTTGGAGGTGCACAGAATGAGCTACCT
CTAGCAGAACGTCGAGGACTACTCCAGAAAGTTTTTGTACAG
gtatgaaaggtgctatttgcctacctccaccctatttaaagggaagtgggtatacttcct
aaatagatgttttacatattccattttttaactcatatttcattttatttatgatagtat
gactttatctcatataattgtcacattttttgaatctgcagaaataatattgaaatattc
EXON 6  193 bp
attgtggttttaattttcatttccctgatgattagtgatgttgagcattttttcatatac
ctgttggccatttctatgtcttcttttgagagcagtccattcagctcatttgcccatttt
taaatcagattatttgatttttgcttatacactcttgttttgttttgttttattttttag
ATCTTAGTGAAACTGTGCAGTTTTGTTTCCCCTGCGGAGGAGCTGGCTCAGAAAGATGAT
CTCCAGCTTCTATTCAGTGCAATAACCTCTTGGTGCCCTCCCTATAACCTGCCTTGGAGA
AAGAGTGCTGGAGAAGTCCTCATGACCATATCTCGTCATGGTCTTAGTGTCAATGTAGTG
AAGTATATTCATG
gtgaatatctctttatatatttaagtgttctaaatttcttccacttttcttcatttaata
atagatttatttttatctttcagtattctaaagcttgttctttaaaataaaaaataaatt
tgcccagagaaaagaaaatattttttttcatctgtggggcatttcaaatgtaaaacattc
EXON 7  187 bp
gcagtgctttcccaatgcatatgactcttatattgacttttagaatgtgttacatttatc
tcatagtattttacagatatgttaaaatttaatgtttcattaaacaacagttaacaatta
aaaaatttttaagcgattgtcaggaataatgcatatttatttaattatctattcttacag
AGAAAGAGTGTTTATCTACATGTGTTCAGAATATGCAGCAATCAGATGACCTGTCTCCCC
TAGAAATTGTCGAAATGTTTGCTGGGCTTTCTTGTTTCCTCAAAGATTCCAGCGATGTTT
CCCAAACACTTCTGGATGATTTTCGGATATGGCAAGGATATAATTTTCTTTGTGATCTCT
TGCTTAG
gtaagactgctcaatttaagaatgtattttaaatgtctactcagtcttttttatcaaaga
aaacaatgtgatttggggttataggaaaagcaaattaaggaaacacttatttaatgtata
cctggctttactcccttctttttctggtgcaatcacagcttactgtagcttcgtattcct
EXON 8  167 bp
tgtgttctcaggaaagccgtggttaaaagataattccctaatgaccccagtgttctttca
gtacttcccagagtactttatacatttatttactgcatataaaattgaaaaatactttgt
gttaaatctgagaacacaaccaaagagaaaaaaaatactttctaaatcatacttttctag
ATTGGAACAAGCAAAAGAGGCAGAATCCAAAGATGCCTTGAAAGATCTGGTTAATCTGAT
AACTTCCCTAACAACATATGGTGTCAGTGAACTAAAACCAGCTGGTATTACCACAGGGGC
ACCCTTTTTATTGCCTGGATTTGCAGTACCTCAGCCTGCAGGCAAAG
gtgagtcttgttttttcccttctgtgctactgagagaaatagagaaagaatgaatttgtc
ttattttggtatattactttttgtttctgttatatatataaaagtaatatagtttccctt
aaagcttgttttttttttaatggtttaagtatttcttaagtaataacctttaatctagca
EXON 9  468 bp
tatttttaattaaatgatttgaacctgatgaagaaaaataagaccttttgtgaaaacagg
gttatgttcttagtaaataattgataaatgttataattcatgatgtgtttaaacagacta
gtttgccatcattaaaatatcacatagtacctacttttatgtttttcttttctgttctag
GTCACAGTGTGAGAAACGTCCAGGCCTTTGCAGTTCTTCAGAATGCATTTTTAAAAGCAA
AAACCAGCTTCCTTGCCCAAATCATCCTTGATGCTATCACAAATATTTACATGGCTGACA
ATGCCAATTACTTCATCCTAGAGTCACAGCACACATTGTCACAGTTTGCAGAGAAGATTT
CTAAACTCCCAGAAGTACAAAACAAATACTTTGAGATGCTGGAGTTTGTTGTTTTTAGCT
TAAATTATATACCTTGTAAAGAACTTATTAGTGTCAGTATCCTCTTAAAATCTAGCTCTT
CTTATCACTGTAGCATTATTGCAATGAAAACACTTCTTAAGTTTACAAGACATGACTACA
TATTTAAAGACGTGTTCAGGGAGGTTGGCCTTTTGGAGGTCATGGTAAACCTTTTGCATA
AATATGCTGCCCTGTTGAAGGATCCAACTCAGGCACTAAATGAACAAG
gtaaagtattgtctgtaattttatttttatttgaaaaggggttcaaaacagagaattttt
tgttcttgttcccattctttggttattgatttcaatgacttcctaatgtgcattattgtg
acatattagtgaactgtattttccaaaatttacaggttcattcaacctctgttaggtaat
EXON 10  102 bp
attttgagcctacttttgccaaatgttggatgcatgcatcgttttaaagattatattata
tctgtcctattaggggtaaaactgaatactgaagaaataaagaaattattacagtaaaac
ggaatcaagaaaaaataagcttatcacttttgtaatttggacctttgaacctttttttag
GGGACTCAAGAAATAATAGTTCAGTTGAAGACCAAAAACACCTGGCTTTATTGGTTATGG
AGACCTTGACAGTGCTTCTTCAAGGATCAAACACAAATGCAG
gtaatttaaaaagctgcaagcaaatactttgggagattaccactgattacatcttctgtg
gttattcttgcttctgaaatcttcctgtcactttagagaaaaaactattgattcagtgat
ggtacccgtcatgtccctaaaaatgcagtgcttttgaccatcaggagcaccttgatgaca
EXON 11  194 bp
ttgctgacaacccactgtgcaaatttgtattgtaatttaaaaggtgaaatagttgggtag
gttttatttacattattatgagttactttacctacaaaaaataactgaatgttaattcat
ctgacttgtctcagaatattttaaagtagccattgttggactttttctccttccttcaag
GAATTTTTCGAGAATTTGGAGGTGCAAGATGTGCACATAATATAGTAAAGTACCCTCAAT
GCCGGCAGCATGCCTTGATGACTATCCAACAGCTGGTGCTCTCCCCAAATGGGGACGATG
ACATGGGCACTCTCCTGGGGCTAATGCATTCAGCCCCACCGACGGAATTGCAGTTGAAGA
CTGATATTTTAAGG
gtaagtttgataaatgtgtttcccttcttttactactaaaatctgtggttatttttagat
gatctgtatttaagttagagacagggaaattaaaaaaaatccaaattacccaagaaacct
cacaactttgtacacgttaggaacttggaaaaactccagtcatttatgtctttcagtata
EXON 12  1479 bp
tttaatgtggcttttttaattagcaaactatttgatatgctttataggaccgtttattgg
gtaaatgataaaaacatgtcagattcacagaatgtacaacctccatatacatgcatagtg
gtttttttttttttttgaattatgtgtattttcatttgttttttcttttgtctcctgtag
GCCCTCCTGTCGGTCCTTCGAGAAAGCCATCGTTCAAGAACAGTTTTTAGGAAAGTTGGA
GGATTTGTGTACATTACATCCTTGCTCGTTGCTATGGAAAGATCTTTGAGCTGTCCACCC
AAGAATGGCTGGGAGAAAGTGAACCAGAATCAAGTGTTTGAACTTCTTCACACTGTGTTC
TGCACGTTGACTGCAGCAATGCGCTATGAGCCAGCCAACTCTCATTTCTTCAAAACAGAG
ATTCAGTATGAGAAGTTGGCAGATGCTGTTCGATTTCTTGGCTGCTTCTCAGACCTAAGA
AAAATAAGCGCCATGAATGTCTTCCCCTCAAATACACAGCCATTTCAAAGACTTTTAGAG
GAAGATGTAATCTCAATAGAATCAGTGTCACCCACGTTACGGCACTGCAGTAAACTTTTT
ATTTATCTTTACAAAGTAGCCACAGATTCTTTTGACAGGTATGGCTCTGCTCTGTCCTCT
GAATTAAAGGGTGTATACTAAGCATGACTTCAACATTAAGACTTGAATTATGAGTTAATC
CAAAAGAATATGAAAACAGATGACTCTTCTCCTATTTGTTTGAAGTGTATCACTTTATTT
TTGAATATTACTCTTGCTCTGGTATTGTTTTTTTTTTTTTTTAGCATGGAAGCCTGTGTA
CTATTTGTAAATTCAGGTTCAATTAGTTCTCATTGCAGTTATTGGAACAGTTTCTATGAA
GTTTCCTTTAATGATAGTGTTTACTGTTGTTTTTTTTCTTTTTAGCCTCAAAAGGTGCAT
CTGGACTTATTGATATGTGTTATCAATAGAACATCATTATGATTATTCTTATTTCCAGAC
ACGTACTCCATCATTCTCCACATATCATACTCCTCAAAAAATGATATAGTTCCCAAAGAG
AGGTGTCAGTGTCTTGAACCGTCAAGTTCAAGAGGCCATCAGACTCAATATTTACTCATT
CCTTCATGAAATAAGTACTTAACAAAAAGCTGCTGCATGCCAAGTCACTGTGCTAGGCAT
TGAGGATTCAGCTCTACACAGGGCTGTCTTGGTCCTTGCTATCTTTTAGCTAAAATGTAG
ACACATAAATAAACAATTACATATAGTGTGACACATTCTACAGTGGGGGAATCCAGGGTT
CTCAGGCAGATTGTAGGAGAGCCACTTCATCTAGATCACTTATTTTCAGTGCTTCAACTG
TGTTTTCAATGAAGATGTCACTTTGAAAATAATACTTCTAATTTATGCCCCAAGTGTTAT
TGCTTTTAACTTACCATAGTTTTACTACATAAAATAAATGAACTGCCCTCATCAATAGAC
CATGTAACTACATTGGATAGAGCTTGTAATAGGTTTTGTGTCCTTTTCTGTGGAATATCT
GCTTTGAAGTATCAACTGAGATATTTCCTGCTTCTTAACAAGATTTCTTAGTCCTCAGTA
TTTACATTTAAAAATCCAAACAGCTTTGACAACAATTGT
aaaaaaaaaaatcattaaacttctgcttttccctatcttgaagtaaaatgcatatgtata
gttaatttatcgaaaacacaggacagtgtagtgttctaggaatgagctatataaatttgt
gtattcagattcaacctcttttcccttgatttctacttatcctagttagaatacatcatt