Gene WDFY3 Variant 2
DNA : 13.40 KbNT_016354
mRNA : 4650 bp NM_178585
CDS : 846 bp NP_848700
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  566 bp
caggcacctggggattctgtttactgtatgccctcttggagatatataatgtgtattagc
atatgcaagactctgagaggtttttgtaggaaacaaaaaagtttacttagttgaactatg
tttttgttttgtttttgagacagagtgagttgctctgtcgcccaggctggagtgtagtgg
TGCAATCTCGGCTTACTGAAACCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCATCAGC
CTCCCAAGTAGCTGGAATTACAAGCATGCACTGCTATGCCCGGCTAATTTTTGTACTTCT
AGTAGAGACAGGGTTTCACCATGTTGACCTGGCTGGTCTCAAACTCCTGACCTCAAATGA
TCCGCCCATCTTGGCTTCCCAAAGTGCTGGGATTATAGGCAGCACTACACCTGGCCTGAA
CCATGTTTTTAAACTAATATGACTATAATCTTTTTCCCTGTACTTTGAAACAGCCATTGT
GTGCAGGCAGCCCGCTGCCACATCTTCCAAGATACGGGAAATCTAACTGTATAACATGAT
GGAAATTAAGTTATCTGTTAACCCTGACAGTCTCTCTTCATTGAGTAATGTAAATTGGTT
CCTTAATCTGTTTCTTAACTTTTTAATTTTTGTACTTATTTAAATTTAGTTTTGGAGAAT
GGAATTTTTGCAAGTTCCTGAAACACCAGCTCCTGAGCCTGCTGAAGTCCTAGAAATGCA
GGAAGACTGTCCAGAAGCACAAATAG
gtatttaatactttctaaaaatgactcaaatcgttttcatatttcttttaagtcactgtg
gataagcttataccaaacaacataaagaggagcccaaggttgggcactgcttggagaagc
atggttgctgcctgttgtgtgattcctttgagcagacatgcaaggttttctctacttcac
EXON 2  324 bp
ttctttgctctctgtactctagccaaaaatcctggcacttactttcttttttgttacact
tagcttaaaatattatgtctatagaggcttataactgggagaaaaaaaatactagcagaa
caaagctgggtgtaactttgatggttccgtatgttccaattctctcaatgcttcacccag
GGCAGGAAGCCCAAGACGAGGACAGCAGTGATTCAGAAGCAGATGAGCAGAGCATCAGCC
AGGACCCTAAGGACACTCCAAGCCAACCCAGCAGCACCAGCCACAGGCCCCGGGCAGCCT
CCTGCCGCGCAACAGCCGCCTGGTGTACTGACAGTGGCTCTGACGACTCCAGACGCTGGT
CCGACCAGCTCAGTCTAGATGAGAAAGACGGCTTCATATTTGTGAACTATTCAGAGGGCC
AGACCAGAGCCCATCTGCAGGGCCCCCTTAGCCACCCCCACCCCAATCCCATTGAGGTGC
GGAATTACAGCAGATTGAAACCTG
gtaacttgaagtctggtatctatttctcactccttatatgtggtgtgagggttggtggat
tgaggcagtggggtctagctctccctgggccccaccctggatgtgccccgtgagctgggc
cactcacacagaatgcctctttacacagaaggcctcttcagtttcttctagtgtaaagtg
EXON 3  112 bp
gttaatgtcaagctaggtagctttactttcaaccaaggcagcagctgccgagaactggaa
aagctgctgtagctgtatgttgaggtaccctaagtttaaggccaccatcttagagtagtt
ctccccagtattggcttctctcagttgagttatgttgtgtcctccacttctccattccag
GGTACCGATGGGAACGGCAGCTGGTGTTCAGGAGTAAGCTGACTATGCACACAGCCTTTG
ATCGAAAGGACAATGCACACCCAGCTGAGGTCACTGCCTTGGGCATCTCCAA
gtaagtgtcaggctttttccagctccgcttcccatctgagtcatttggttagccaagggc
cacatactccagcccagtctttggggaaaacagattttatttgtattatcgtatgtagct
caaagagataaatttgaagaagaaccctgttagtgtgtggatatttttcttttctttttc
EXON 4  198 bp
tttgggctcggttcagtttttgtctgtttacacatacatctctgagtgaatcaaggggtc
tctccaggacccttaccagccccgacctcaaaacacacatccaccaaaatccagagagcc
tcaagaaggagatcacagaagccttccgtgcagtgacctcctctgtcgtgtctcctgcag
GGATCACAGTAGGATCCTCGTTGGTGACAGTCGAGGCCGAGTTTTCAGCTGGTCTGTGAG
TGACCAGCCAGGCCGTTCTGCTGCTGATCACTGGGTGAAGGATGAAGGTGGTGACAGCTG
CTCAGGCTGCTCGGTGAGGTTTTCACTCACAGAAAGACGACACCATTGCAGGAACTGTGG
TCAGCTCTTCTGCCAGAA
gtaagataagatatctgctttttgaatttacattgattaagctctaaggttgttaattat
gtcctgcacacaggttctgatttgccctggcgtccccactacagtatgccttgttggtat
gaaccagtcttcactttttctgttcttctttattactacaattaggaaatttttctgtca
EXON 5  3450 bp
tcttcatagactgaaacaaataatacagctttccttttagtccttgttcagccacacaac
acaaaccagtatggcctttggcattttactgcaagctttccattcgattattaatgtttc
cggtgcccatgatcaagcatggagaagacctataattaattgacttttcctttcctttag
GTGCAGTCGCTTTCAATCTGAAATCAAACGCTTGAAAATCTCATCCCCGGTGCGTGTTTG
TCAGAACTGTTATTATAACTTACAGCATGAGAGAGGTTCAGAAGATGGGCCTCGAAATTG
TTGAAGATTCAACAAGCTGAGTGGAGACCATGGTCTGTAGACCCCTTCCCGATTCTCCTG
TCCCAGCTTGGAAGGCATTGAAAACAGTCTCCGTTTACACATCTCTTCATACCACGTGTT
TGAAGTGTTAAAATTCAAAGGGATCATTGAATAAAACGGGTGTAGAGTACAGGAATGGGG
CAGACGCGATTCAGGTGAACAGCACAAGAAGAATATGAGGTGGTTCCTAGGAGCAACACT
TTCGACCTCCAGTTCTCCCTGATGACAGTAGCTGTCTCCAAGAGAAAAATCCTCACTTAT
TAACTCTCTTTTCTTGCATCTCATTTTTATAGAGCTACTCATCCTTATTTGGAAAAACCA
ACAACAAAAAAGGCTTTTAGAAAATGGTTGTAAATCTGACTTCTTTGCAAGTAACTATGT
ATATTGTAAATAGATATAAAAGGCCTTTTTTCTAAATAAGGACTTAACTGCCTGTAACAT
GAAACTTCAAACTAAACCACTAACTCAATGAACTACTTATGGTTTGTCTGACATCCCTCA
CTTACCAATTAATTATAAATATGTTTTTTTAAATCCCCAAAGACATTATCTGTGGTCTTT
TTTTCCTTTCAAGCTCAGCCTGTGTGCCTGATGTCATTTCTTTCAAGTTGCCCACAGTAT
CTCCACTTAAACTAGGCTAGTAACCAAAATAATGTGGACCTTCTTTAGGAAACAGTGTGG
GAGAATAGGAGTCCAGCCGTAAGATAAACTGGAAATATTTGGGCGTCTTGTACCTGGCTA
CGCACCACCTCAGTGTTGTTCCTACATAAACAGGGCCCCTTTTAAACTTGTATGTGGACT
GCTGTTTGGTCAAAGAATACCTTCTTAGCATTGCAGAAAGGTGGTCAGATGACCAGTGTA
GTGCAGGAAACAGCCCTGTCTCAACTAATGGAAATATATTTGCATGTAACCCAAAATTAG
CTTATCTTGCATAGAACATAATAAGTATGTGTCTTTGGTGACACTAATGTTCTACTATAG
CTTATTTTCAAACAAGGGGTAAAAAAAGGAAAGAAAGAAGTGTACAGAATTAACATATAA
ACTTTGTTGTAAAACTGAATCATGTCAGAACTGCTTAAAATTAACCTTTACCATTTAATG
TCATCTACCTGAAAACAGTGAGATTTATACTGTATCAATGTCTATTTTTTTGTTTTTGCT
ATGAATATAATTACAGTATTTTAATATTTAGTTATTTAATTTGTTCTACTAGTTGGATAC
AGAACACACAAATCCAGGGGGATTAAAGCTGGAAGGGGCTAAGAGATTAGTTTACAGAGA
AAAGGCTTGGTGGTGGGATTTTTTTAAATGTGTGTTATGTACATATATATATATATATAA
TATATATTAAAAATGAAACAATTAATCTAGATTTTAACATTTTCAGAAACTTAGTGATAA
CATTATGAACAATTCTAAAAGCCCTGTGATTTGAAAAATATAGAATCATTAATGGCCCAA
GATAGGCCTTCACACCTTCACAGGTGCGAAAGGAAAGGCCTTCACACCCTCACAGAGGCA
TCATGCAAAGGACAGCGGCTTTGGCTTTTCCAATTTTCCATCTTTAGGCCCTGGTGAGAG
GCACACTTATGCACTAAAATGCACATATATGCACATGCATTCAAAAATAGGCATTTGGTA
CAATGGTGATCTTGTACCTGATGGGCTGAAACCAGCTTAAGAACAAATTTGTTCTTCCTG
ATATGATAACTAGGTCTCCAAGAGAAAATAGAAAGGCTGCTTTAGTGCCTTACGCTTACT
AAATTTAAATCTTTATTTACCTGGGTTTGAGCCTACAGTCTATTTATGATTACATATCAA
AATTGATTAAAACACTTCCATTTCTAAAAGTTCAAATATACTTGTTAATAAAAGGATTAT
CGGCATTAATACTTTAATTTAAAGAAAAGTTGTGTTCTGTTTTCCTTTCTGTGTCTTACT
CCCCCCACACTCTCCCTCCCCCATCACCATCTTCAATTCTAATAAATAATGCTGATGTTC
AACAGTTGCAGAAATTGTGCTATTATGTAACTGTGGGCCTTGCCCCTGTCTGGCCCTCTA
GATGATTTGTAGCAGTGTTATTCTACACTTTTTAAAAGAAGCGTCCTCCTTTTGTCCATG
AATCATGTTTACCCCATACCCAGTGGCAGAGGTGTTCTTTAAAGACTTGAATATATGAAT
GTGTGTGTGTAGTTACTTAAAGGTTATTCCTCTTTGTAATAGGAAACTATATGGGATGAA
CACTTTTAAACTTTCCGACACAACTTCCATTACTAACTTTCTAACAGAACTTCCATAACT
AGAAGGTGGAAACCAAAACCCTCATGGTAGTATTTCCTCTGGCAGCTGGTGCTGTGGGCA
ACTGTTTTGTTCAATCGGGTTTCTTTTCTTTTTGCCTCTAATGCAGAAATCAACAGAATC
ACTCACACATACAAGTACACTCACATACATAAACTAATTATTTCTCTGGATATCTTTCTG
TGTTCCATGTAAATTTATTTACCAACATCTATTGTCAACATGTACATCTACCTTAGTATG
GTCTGCATTCTTTTTCTGAGAGTACCTCATAGGGCTCCTGCCTGATCTTTGTAGTTTGTT
CATTCATCCATCCACCTGTTCATTTGTTCATCCATGTATTCTAACATTTCTATGTAGTGT
GCAACTCTAATGTCATGCTTTTGAAGAAGAGAATAGCTGCCCATAGCAGCCATCCGTCTG
GATAATAGCAAAACACTCTAGATAAGTTATTTTGCACTTTCTTATGTATAAAGTTGGTAG
AAACTTATTTTTGCTTTGTATCATTTAAATACATTTTGTTTTGGTAAATGAACTGTGTAT
AAAATATTTATGCCGTTAAAACTGTTTTTAGAAAGTATTTTTAATTTCAGCAAGTTTGGT
TACTTGTTGCATGACTCTTAACACAGCTGACTTTTTGTGTCAGTGCAATGTATATTTTTT
GTCCTGTTATTAACTTGTAAGCCCTAGTAATGGCCAATTATTTGTACAGCAACAGAAGTA
AATTGAAGATACTGGCTAAGACTGGATTGATTGTGGACTTTTATACTATATTGCAGAAAC
CAATATCTGTTTCTTGGTGGTTATGTAAAAGACCTGAAGAATTACTATCTAGTGTGCAGT
CTGTGATATCTGAATGTTCATTGTATATTTGTCTCTGATGCAAAAAGGTAGAGTAACACA
ATTACAATACATGATTAAATGCAATAGTCCAGGTACTTAAGTAATTTTTTTTTCATTTCA
AATAAATACCTATTTACCACCAAAAGAAAG
aaaaagaaaagttgttaagtcagttattcagggaaggaaaaacagagatctaataactcc
ctaactttatgtagttcttttctagttgtaaatactttcagaagcacctgcataagattg
cagaagtattggctgttaaggttccagttccagttctagtttgactcatccttaaaaatc