Gene UGT2B28 Variant 1
DNA : 14.55 KbNT_077444
mRNA : 1834 bp NM_053039
CDS : 1590 bp NP_444267
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  723 bp
acatccttgagtaaatatgaagtaatcaaactttgtctccttgtcatccatgtactcagg
atgctcctataatatatttactttggattgaaggagttatgttttaacttgattgattta
tctctgtatataagtatgagaaagaaacagtgacttgaaaagaatgattgcattgcacca
GGATGGCTCTGAAGTGGACTTCAGTTCTTCTGCTGATACATCTCGGTTGTTACTTTAGCT
CTGGGAGTTGTGGAAAGGTGCTGGTGTGGACCGGTGAATACAGCCATTGGATGAATATGA
AGACAATCCTGAAAGAGCTTGTTCAGAGAGGTCATGAGGTGACTGTACTGGCATCTTCAG
CTTCCATTCTTTTTGATCCCAATGACGCATTCACTCTTAAACTCGAAGTTTATCCTACAT
CTTTAACTAAAACTGAATTTGAGAATATCATCATGCAACAGGTTAAGAGATGGTCAGACA
TTCAAAAAGATAGCTTTTGGTTATATTTTTCACAAGAACAAGAAATCCTGTGGGAATTTC
ATGACATATTTAGAAACTTCTGTAAAGATGTAGTTTCAAATAAGAAAGTTATGAAAAAAC
TACAAGAGTCAAGATTTGACATCATTTTTGCAGATGCTTTTTTTCCTTGTGGTGAGCTGC
TGGCTGCGCTACTTAACATACCGTTTGTGTACAGTCTCTGCTTCACTCCTGGCTACACAA
TTGAAAGGCACAGTGGAGGACTGATTTTCCCTCCTTCCTACATACCTGTTGTTATGTCAA
AATTAAGTGATCAAATGACTTTCATGGAGAGGGTAAAAAACATGATCTATGTGCTTTATT
TTGACTTTTGGTTCCAAATGTGTGATATGAAGAAGTGGGATCAGTTTTACAGTGAAGTTT
TAG
gtaagaatttgtttaatcgggaacttgaagatctaacttatttgtgtctttgaagcagag
cttatataaagccataaagtcagggaagtggagtttttggtaagtgaatttatgaaatga
aaatacaagatgatctatcaatctcacaaacattatagaaaagcttaaattataaggtct
EXON 2  149 bp
atggacaaaatatataatacataaaaatatattattcatatacatgaatatatgtatata
tttttcaaagcacacaaactttacctacatctttgcctacataattctaacccctttcag
aaagttatgtaaagtaattatcttacatcatccactttttcttttctttattcctgtcag
GAAGACCCACTACCTTATTTGAGACAATGGGGAAAGCTGACATATGGCTTATGCGAAACT
CCTGGAGTTTTCAATTTCCTCATCCATTCTTACCAAACATTGATTTTGTTGGAGGACTCC
ACTGCAAACCTGCCAAACCCCTACCTAAG
gtaaacatactttcgttggttttattttgttggcttcgaagtttcagtagaaatgagtct
atagccttcattcaaaatgtttgacttacactgaaagaaagatgggaagtaggtggtgta
aagcagataccaaatagaaactcatgtatatgttaataccatcacatgtatgtgagtttt
EXON 3  132 bp
gccaactacctcaaacatcttcttgtaaagaacctgagtgattgagtcagttaaaaaata
ttatttactccaataattcctcaaaatacttgattttctctctttaatatttggtaccaa
ttctttagtagtgcctgctgtggtgatactcttttgtgattaaacaattttttttcacag
GAAATGGAGGAATTTGTACAGAGCTCTGGTGAAAATGGTGTTGTGGTGTTTTCTCTGGGG
TCAGTGATAAGTAACATGACAGCAGAAAGGGCCAACGTAATTGCAACAGCCCTTGCCAAG
ATCCCACAAAAG
gtaagataaagtgccttactggtgtggaaaactactgaaagaggctgttaaagtttgaga
tctacacagaaagaatattaaggctagactgaactctttacagccaaatacagtcttaaa
tatcttgtgtagcttccaccgacacaagtcatagttgtgcctcagacttagtggttacat
EXON 4  88 bp
atatatctaaatcattataaaagttaagaaaataaaatgtgagtattgtttttacatcaa
tctctgagtagatttatttactaacatcccttgatctcattcctaccctttttacagttc
taacattctataatttttgagttccactcatggaataagatattctctttactgtaacag
GTTCTGTGGAGATTTGATGGGAATAAACCAGATGCCTTAGGTCTCAATACTCGGCTGTAT
AAGTGGATACCCCAGAATGACCTTCTAG
gtaacactctggtgaacaaatactggatatattagtaactgcacattagaatgttaatag
tttatcttgaaacatgcttattgaatatttattataggaaaacaaaaagaacttctttgt
atttattttccagtcctaggggaaaagaatatggtagaattgctggcattttatgatatt
EXON 5  220 bp
caccacggagacttcaattacatctcctaaacaagtacgtgtttattcctctgaagtctg
aaaagtaatggcaaattagtttaatgtgttatctagaaaacactgtcactttcagagcat
ttcattgtgtatcgcattttattcctatgaataattttgctaaaattcatccaatcctag
GTCTTCCAAAAACCAGAGCTTTTATAACTCATGGTGGAGCCAATGGCATCTATGAGGCAA
TCTACCATGGGATCCCTATGGTAGGCATTCCATTGTTTTGGGATCAACCTGATAACATTG
CTCACATGAAGGCCAAGGGAGCAGCTGTTAGACTGGACTTCCACACAATGTCGAGTACAG
ACCTGCTGAATGCACTGAAGACAGTAATTAATGATCCTTC
gtgagtagaacagtatttttcactaggtggtatttgtagatagcttctcttttcaatagt
gagcatgagtttcatcctttttataagagagtaatcttgaaagaatttaaatgatttaac
caatctgaaatctgctttgttttttatctgttatttaaaaattgtgcttgaatcccatac
EXON 6  522 bp
agaaaagtccaatttaaaagcccaactatctatgatgactcaaattaaaatacacaaatt
ctctgtcaattctttcaaatttactttgaattatttgacactttaaaagcctttcataga
cttgatacatacaggccagttaacttactttcagtgttggtatctttatttttatccttc
AGATATAAAGAGAATGTTATGAAATTATCAATAATTCAACATGATCAACCAGTAAAGCCC
CTGCATCGAGCAGTCTTCTGGATTGAATTTGTGATGTGCCACAAAGGAGCCAAACACCTT
CGAGTTGCAGCCCGTGACCTCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTTT
CTGCTGGCCTGTGTGGCAACTGTGATATTTGTCGTCACAAAGTTTTGTCTGTTTTGTTTC
TGGAAGTTTGCTAGAAAAGGGAAGAAGGGAAAAAGAGATTAGTTATGTCTGACATTTGAA
GCTGGAAAACCAGATAGATGGGTTGACATCAGTTTATTCCAGCAAGAAAGAAAAGATTGT
TATGCAAGATTTCTTTCTTCCTGTGACAAAAAAAAAAACTTTTCAAAATCTACCTTGTCA
AGTAAAAATTTGTTTTTCAGAGATTTACCACCCAGGTAATGGTTAGAAATATTCTGTGGC
AATGAAGAAAACACTAGGGAAAATAAAAAATAATATAAAGCC
atatgagctcatattgaaatttgttgcacttatattgagatttgttgtttgaattcacaa
gttacataaaaatattactcagtttaactacatttcacacattttatataaacacaagaa
cattaagaagtctactgacagtatcagtagtgttttgcacatactcagaataatttggct