Gene TRPC3 Variant 1
DNA : 54.18 KbNT_016354
mRNA : 3423 bp NM_003305
CDS : 2547 bp NP_003296
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1186 bp
aaaaaagtatttaaataaacaaaaattttaaaataaagagaaaaagatgaaactaagatc
ctgcaacatgatacttggcctaaatcctgtgcttttgtagggggctgagggtcaatgatt
ttatttagttaaaaggatgcaatgacttggcaggagtgttttggcctcattctttaaaaa
ATTAACTTCTCTTAGTCTTCAAGCCTAGTACTTGAATGTCAAGTACCTGCAAGCCTCAAT
GTCCAAGACTTTTAAGAGCGGAAGGTACGATGAGTTCCATCTTTACTAGGGTCACAAGGA
AGGCATGGGTATATGGAAATTTTTATTATTATTCCATCTGAATATCATTTTCTAGAGAAT
AGGAGCTTTTGTTCTGAAGGGCTGCCGGCTTCCTTCTGGGATCTAGCAGCCAGGGTTAGA
TCACAGGTGTCACTTTCAGGCGAGTAGTTAGCAACGGTATCGCTAGCAACTGAGCCGACC
CCTGCAGCCAGAGGTTTGCAGTGGGTAGTGTGTATTCCAGAAAGGGCCCTGACATGTGAA
AGGAAGGAATGTGCCCTAATATTCTACAGTTGTTTTATCGTTGCTACTGATTAGGTCCAT
GGAGGGAAGCCCATCCCTGAGACGCATGACAGTGATGCGGGAGAAGGGCCGGCGCCAGGC
TGTCAGGGGCCCGGCCTTCATGTTCAATGACCGCGGCACCAGCCTCACCGCCGAGGAGGA
GCGCTTCCTCGACGCCGCCGAGTACGGCAACATCCCAGTGGTGCGCAAGATGCTGGAGGA
GTCCAAGACGCTGAACGTCAACTGCGTGGACTACATGGGCCAGAACGCGCTGCAGCTGGC
TGTGGGCAACGAGCACCTGGAGGTGACCGAGCTGCTGCTCAAGAAGGAGAACCTGGCGCG
CATTGGCGACGCCCTGCTGCTCGCCATCAGCAAGGGCTACGTGCGCATCGTAGAGGCCAT
CCTCAACCACCCTGGCTTCGCGGCCAGCAAGCGTCTCACTCTGAGCCCCTGTGAGCAGGA
GCTGCAGGACGACGACTTCTACGCTTACGACGAGGACGGCACGCGCTTCTCGCCGGACAT
CACCCCCATCATCCTGGCGGCGCACTGCCAGAAATACGAAGTGGTGCACATGCTGCTGAT
GAAGGGTGCCAGGATCGAGCGGCCGCACGACTATTTCTGCAAGTGCGGGGACTGCATGGA
GAAGCAGAGGCACGACTCCTTCAGCCACTCACGCTCGAGGATCAATGCCTACAAGGGGCT
GGCCAGCCCGGCTTACCTCTCATTGTCCAGCGAGGACCCGGTGCTTACGGCCCTAGAGCT
CAGCAACGAGCTGGCCAAGCTGGCCAACATAGAGAAGGAGTTCAAG
gtaagctttgcgctctaccccggctgctctgtgtgctcacccaacttccccgctgctgcc
tggcctgctctgccaccgttcgctccacattcggttttgcccagtgaatgtgaaatcacg
agggactgagaacgtcattcagacctcatctaatgttttctttctccctctcaatgatgg
EXON 2  189 bp
tggctaaagggttgggtgggtgcaaatccagcctgtattcagctcaacaagccttgcatc
caggtgggctgcagctttctacccccaaaagaagggatacctttttctaattcacccaaa
tactttccactgaataaaagcaaattatttgtgttaaaacactaaacctcttgttcttag
AATGACTATCGGAAGCTCTCCATGCAATGCAAAGACTTTGTAGTGGGTGTGCTGGATCTC
TGCCGAGACTCAGAAGAGGTAGAAGCCATTCTGAATGGAGATCTGGAATCAGCAGAGCCT
CTGGAGGTACACAGGCACAAAGCTTCATTAAGTCGTGTCAAACTTGCCATTAAGTATGAA
GTCAAAAAG
gtgagtgggcctactttcatctagtgccatattagaataaacatgtgatacaaactatgc
cataatcctaggaaaattattaaaataataagactagacgctagtaggctgggcaacata
atgagactgtgtctgtacaaaaaagaaacaaaattagctgggcatgatggcatgtgcctg
EXON 3  165 bp
aattttgaaaaatggagggaaagctaagaagaatattaccagaaccttccagtaccaata
tgctagaaaaaatatgctttaatatctttaggatgcatgtgtatttaatagttgagctat
tgacaatggtatggtaacttacctttctctccccttctcaaactctctctctcccaatag
TTTGTGGCTCATCCCAACTGCCAGCAGCAGCTCTTGACGATCTGGTATGAGAACCTCTCA
GGCCTAAGGGAGCAGACCATAGCTATCAAGTGTCTCGTTGTGCTGGTCGTGGCCCTGGGC
CTTCCATTCCTGGCCATTGGCTACTGGATCGCACCTTGCAGCAGG
gtacttgctttctacatctatttcctctgtggtggtgtactgtgtctctttgggataaaa
aaataaaaagcttcatgcttaagaatcttatcagttttaccctgaatgttaattgattca
agaacacagattctcctttttaattactggatcaattcaaataagggatgaaaaaggatt
EXON 4  217 bp
tatttttggaggaagcattcccctaaaaaagaatatttttcataatataaagctttttgg
aaacagaagcagaattttgagtgttctcctttcatctattttttttaatcctatgttgta
atctccacaagtgaaagccagattttctgaagcaaacttttcctctttggtttgttacag
CTGGGGAAAATTCTGCGAAGCCCTTTTATGAAGTTTGTAGCACATGCAGCTTCTTTCATC
ATCTTCCTGGGTCTGCTTGTGTTCAATGCCTCAGACAGGTTCGAAGGCATCACCACGCTG
CCCAATATCACAGTTACTGACTATCCCAAACAGATCTTCAGGGTGAAAACCACCCAGTTT
ACATGGACTGAAATGCTAATTATGGTCTGGGTTCTTG
gtaagtcttttattttaaatatcctaatttctaccaaaaggtaattatagaaataattgt
cattttctattgaaaaaaaatgttattatatcttatatggtgacaacatcactgttgcaa
gataagctaaatagcaaaataaccaaataattttctagctagataatgccaaaaggtgtc
EXON 5  234 bp
tcttccatttaactctgcacagggcctcagtgaccatacagtcagtcagtcaatgctttg
tgatgcctagtactgtgcttgacgtgtagggtagagatgtgacctgatggtggacacaat
aatggcttctcagtctggcctgtaaaatctgacctgcaccctctgtatttgttgtgacag
GAATGATGTGGTCTGAATGTAAAGAGCTCTGGCTGGAAGGACCTAGGGAATACATTTTGC
AGTTGTGGAATGTGCTTGACTTTGGGATGCTGTCCATCTTCATTGCTGCTTTCACAGCCA
GATTCCTAGCTTTCCTTCAGGCAACGAAGGCACAACAGTATGTGGACAGTTACGTCCAAG
AGAGTGACCTCAGTGAAGTGACACTCCCACCAGAGATACAGTATTTCACTTATG
gtaagttgttagcttcagggtccccttgtgttttgggaaaggtattggaaccacattttg
gaaggaaatgccaattggagtatgtttagtatgagaggtgtattgaatatttatggacag
tggagaaagcatgaactttggaacctacaaaactggattcatttcaaggctctgaccccc
EXON 6  265 bp
gaatttacgtttctggtttaagatgaaaatagtccctggacagttaattaaatctagatt
agtttcaactgagatggtaaccacctacctacaagatagatcctatttaaggtatttgct
ttgcgtagttggcaatgaatagaaagctccatttttaatctctttctctcttttttctag
CTAGAGATAAATGGCTCCCTTCTGACCCTCAGATTATATCTGAAGGCCTTTATGCCATAG
CTGTTGTGCTCAGCTTCTCTCGGATTGCGTACATCCTCCCTGCAAATGAGAGCTTTGGCC
CCCTGCAGATCTCTCTTGGAAGGACTGTAAAGGACATATTCAAGTTCATGGTCCTCTTTA
TTATGGTGTTTTTTGCCTTTATGATTGGCATGTTCATACTTTATTCTTACTACCTTGGGG
CTAAAGTTAATGCTGCTTTTACCAC
gtaagtaaaatatcttattatacaggtatgataaagagaaattctaaccaatctagagga
agcaaaggaaaaatttctctgattgtaataaagatgtttttaagcacagaaaataatcca
tcaaaaacagttagtgcttgtgttgattatattgctctgaaggctcatctctgagcttag
EXON 7  196 bp
gaaaacctgaaagaataatttttctatgaaatgtcataacaaagtaatcctgctcttgga
gtatattatggtggcattttacatctgtacagtagttaaaccctaacttgttttttactt
ttcactcttagatattgaaaactgttaacttacttactttgtatcttattttttcaacag
TGTAGAAGAAAGTTTCAAGACTTTATTTTGGTCAATATTTGGGTTGTCTGAAGTGACTTC
CGTTGTGCTCAAATATGATCACAAATTCATAGAAAATATTGGATACGTTCTTTATGGAAT
ATACAATGTAACTATGGTGGTCGTTTTACTCAACATGCTAATTGCTATGATTAATAGCTC
ATATCAAGAAATTGAG
gtaaatcggttttctatccatagtatctatccttgtcatcctattctgatagtacacatc
tgcttctgtaccctgtggctgagctccagctcatgtaacaaagaggcttatatccacaca
gagcctgagcctttccctgtgttttctacctggatagatagctctacacattctgctgtc
EXON 8  210 bp
agtatcttatatttgaaaaatgagaatattgtgtaggtctatagaatatatgtagataaa
tgtgtataagttacctatttcaaaaacgtaacttagattcattgtaaaaaacctattagc
aacagtcactagaatatttagcatttaaaattagtttttttttctatttttgtgacacag
GATGACAGTGATGTAGAATGGAAGTTTGCTCGTTCAAAACTTTGGTTATCCTATTTTGAT
GATGGAAAAACATTACCTCCACCTTTCAGTCTAGTTCCTAGTCCAAAATCATTTGTTTAT
TTCATCATGCGAATTGTTAACTTTCCCAAATGCAGAAGGAGAAGGCTTCAGAAGGATATA
GAAATGGGAATGGGTAACTCAAAGTCCAGG
gtaggtatcgaaaacttaccaagaccttaaaataaatgttctgtcttttttttcttgtct
tctgatgtttgttcaataatttttatgtgtgaacttagaagatgttaaaagtaactgtct
agtccacagtctttcacagactaatactaaatattttcatgatgtttcaagaagtcactg
EXON 9  84 bp
attgctcacagtaattttaacctttgggaatatattacatcacttacaaagctcaacttc
cacaaaatgtttcttgggaatgttgactccagaaatgttatcaaggagaataaatggatt
atattttttattccaaatgaatgtattctaatttactaggttaattgtattttttcctag
TTAAACCTCTTCACTCAGTCTAACTCAAGAGTTTTTGAATCACACAGTTTTAACAGCATT
CTCAATCAGCCAACACGTTATCAG
gtaagcattcattagacgtatctcttgatctctatgtgattccatatatgtctgcgtgtg
tgtttgtgtgtgtgtcatgagttgagttatattcttgagatataccattataccatgagg
atagttcagaacaaagaaaatgattcaacacctgtgaaattttttaaaaaaaaattaaaa
EXON 10  76 bp
tcagtagaaggcattaagagagttaagttctgaaacctgcgtaatttttctatacatagt
tataaaatttttttctcccctgagttgtttgctttacaggtatgtaagcctctttggaaa
ataggattggggcacttatgtatatcattggagatctaatcatttacttttgcccaacag
CAGATAATGAAAAGACTTATAAAGCGGTATGTTTTGAAAGCACAAGTAGACAAAGAAAAT
GATGAAGTTAATGAAG
gtaagcatctccaacttaaaaaatatccttttatagctaacttaatgaacctggaaaact
taatgttgaggcatattttaaaaatccaatcccaggttatagtttggatgcctctaagat
gggaggaggatcttatgttacgtttctaaaacttcatcttttaaaataaacagttattta
EXON 11  601 bp
caaaggtcagtgtacctttaaagacagatgtttcttaaatattttaaagaaaaaactttg
aagtagctaccttggagaccttatgaagcaaatacattgatattgtaagaatttcactct
ttgttcatttctaaatccaaagagcaacttaccaataattttttaatatcaatactatag
GTGAATTAAAAGAAATCAAGCAAGATATCTCCAGCCTTCGTTATGAACTTTTGGAAGACA
AGAGCCAAGCAACTGAGGAATTAGCCATTCTAATTCATAAACTTAGTGAGAAACTGAATC
CCAGCATGCTGAGATGTGAATGATGCAGCAACCTGGATTTGGCTTTGACTATAGCACAAA
TGTGGGCAATAATATTTCTAAGTATGAAATACTTGAAAAACTATGATGTAAATTTTTAGT
ATTAACTACCTTTATCATGTGAACCTTTAAAAGTTAGCTCTTAATGGTTTTATTGTTTTA
TCACATGAAAATGCATTTTATTTGTCTGCTTTGACATTACAGTGGCATACCATTGTGTTG
AAAAGCCCAATATTACTATATTATTGAAACTTTTATTCATTTTAGAGTAAACTCCACATC
TTTGCACTACCTGTTTGCCTCCAAGAGACTATCAGTTCCTTGGGGACAGGGACCATGTCT
TATTCATCTTTGTGTCTCCAGCATCTAGTACAGTGCCTGGTATATAGTAGGTGCTCAATA
AATGTTGAAACCAACTGAACTGCCAACAAAATAAAAATAAAAAGTCTTCACTATGTAGCA
T
accttcccttgtccaagttctgaagaggttttttttttttttttttaatagaaactgaag
acattttacaaccagctatgacttggtaagacattcttagaattttaggtgtcactgata
atcctagaaccactgagccccaagtgaagaatttaacaacaaaatgggttaatgaaaaat