Gene TACC3 Variant 1
DNA : 23.63 KbNT_037623
mRNA : 2778 bp NM_006342
CDS : 2517 bp NP_006333
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  105 bp
tcggcgcccgagcggggggtggggggggagggagggcggagccggcgaggcacagcttcc
cattggacgcccgccctcctgcggtcctgcccccggccgcgcgctgattggccgcgcgaa
ggcaaccgtcggcgtttgaaactccggcgcgccggcggccatcaagggctagaagcgcga
CGGCGGTAGCAGCTAGGCTTGGCCCCCGGCGTGGAGCAGACGCGGACCCCTCCTTCCTGG
CGGCGGCGGCGCGGGCTCAGAGCCCGGCAACGGGCGGGCGGGCAG
gtaggagagcggctacacggcgcggggaggctggggtcctgggggcgcgaggccgtcccg
ccccgccccgccctcggccctcgccctcccgccccggccgccgctttccccgggaagcgt
cccccacggctcctcctggggccgccgccagaacctgtaccgcgccctgtcatgggaccc
EXON 2  163 bp
atggggactcagtctgaggctttctctgccaagagacacgtgtgggaggtgtgagttcca
gagcaatgagcacacctgtgtgggaagtggtcgtgccccttgcagcagctgtcacgtctg
tgtctggacaatgtggtagtgttgccctcacactgacacaaacatgttctgcttttccag
AATGAGTCTGCAGGTCTTAAACGACAAAAATGTCAGCAATGAAAAAAATACAGAAAATTG
CGACTTCCTGTTTTCGCCACCAGAAGTTACCGGAAGATCGTCTGTTCTTCGTGTGTCACA
GAAAGAAAATGTGCCACCCAAGAACCTGGCCAAAGCTATGAAG
gtaagtgtgacctgtacagtgtgtggctggccaggttgccctagggcctgctttcttggt
gacctctgagctgcaggacactgctggtgtggctgtaacagcttgaactaatgaataggt
gctctcctcctcactccgcaacaggtgacttttcagacacctctgcgggatccacagacg
EXON 3  143 bp
aatgtgccacccaagaacctggccaaagctatgaaggtaagtgtgacctgtacagtgtgt
ggctggccaggttgccctagggcctgctttcttggtgacctctgagctgcaggacactgc
tggtgtggctgtaacagcttgaactaatgaataggtgctctcctcctcactccgcaacag
GTGACTTTTCAGACACCTCTGCGGGATCCACAGACGCACAGGATTCTAAGTCCTAGCATG
GCCAGCAAACTTGAGGCTCCTTTCACTCAGGATGACACCCTTGGACTGGAAAACTCACAC
CCGGTCTGGACACAGAAAGAGAA
gtaagtgttggtgctgctggacatgctggagcttcaccctctctgtccgatggttcttgc
aggaaagtgctgtcttgttctatcaggccttggctggattttttgtttgtttgtttgaga
tggagtctcgctctgttgcccacgctggagtgcagtggcgcgatgtccgctcactgcaag
EXON 4  1080 bp
ggacaggaaggaactacattgaggaactgaggtggggggtggagaacgggaagccgtgcc
aagggtgactcagccctgcttctggtgtgagaatgttaaacctatgttgagaatgaatgc
tgaggcccctaacctcaccaggtactcgctgcttcacgttgattaagtctcttttaaaag
CCAACAGCTCATCAAGGAAGTGGATGCCAAAACTACTCATGGAATTCTACAGAAACCAGT
GGAGGCTGACACCGACCTCCTGGGGGATGCAAGCCCAGCCTTTGGGAGTGGCAGCTCCAG
CGAGTCTGGCCCAGGTGCCCTGGCTGACCTGGACTGCTCAAGCTCTTCCCAGAGCCCAGG
AAGTTCTGAGAACCAAATGGTGTCTCCAGGAAAAGTGTCTGGCAGCCCTGAGCAAGCCGT
GGAGGAAAACCTTAGTTCCTATTCCTTAGACAGAAGAGTGACACCCGCCTCTGAGACCCT
AGAAGACCCTTGCAGGACAGAGTCCCAGCACAAAGCGGAGACTCCGCACGGAGCCGAGGA
AGAATGCAAAGCGGAGACTCCGCACGGAGCCGAGGAGGAATGCCGGCACGGTGGGGTCTG
TGCTCCCGCAGCAGTGGCCACTTCGCCTCCTGGTGCAATCCCTAAGGAAGCCTGCGGAGG
AGCACCCCTGCAGGGTCTGCCTGGCGAAGCCCTGGGCTGCCCTGCGGGTGTGGGCACCCC
CGTGCCAGCAGATGGCACTCAGACCCTTACCTGTGCACACACCTCTGCTCCTGAGAGCAC
AGCCCCAACCAACCACCTGGTGGCTGGCAGGGCCATGACCCTGAGTCCTCAGGAAGAAGT
GGCTGCAGGCCAAATGGCCAGCTCCTCGAGGAGCGGACCTGTAAAACTAGAATTTGATGT
ATCTGATGGCGCCACCAGCAAAAGGGCACCCCCACCAAGGAGACTGGGAGAGAGGTCCGG
CCTCAAGCCTCCCTTGAGGAAAGCAGCAGTGAGGCAGCAAAAGGCCCCGCAGGAGGTGGA
GGAGGACGACGGTAGGAGCGGAGCAGGAGAGGACCCCCCCATGCCAGCTTCTCGGGGCTC
TTACCACCTCGACTGGGACAAAATGGATGACCCAAACTTCATCCCGTTCGGAGGTGACAC
CAAGTCTGGTTGCAGTGAGGCCCAGCCCCCAGAAAGCCCTGAGACCAGGCTGGGCCAGCC
AGCGGCTGAACAGTTGCATGCTGGGCCTGCCACGGAGGAGCCAGGTCCCTGTCTGAGCCA

gtaagtgtgaggatgggatggggagcgtggcgtggggcagctgccctgcagtgtatgtgg
tccaggacccgaggccagaagtgtcatcagatactcctttgaggccgggtaggttctgcc
tgaggaggggcctctggataaaaacagggctcaggtggctcccagctgagggtgcttggc
EXON 5  76 bp
ggtgaggcagttttgtggccaggtcgcttgggacagccccatgcctggcacgctctagct
gaatgttcacgtggccggcacagcagtgcagggaaaggcgatggcagctcagtgctggag
caggggacgccggggttatggggtggggggcatgggcctctgctgactctgtctccccag
GCAGCTGCATTCAGCCTCAGCGGAGGACACGCCTGTGGTGCAGTTGGCAGCCGAGACCCC
AACAGCAGAGAGCAAG
gtaaggggtgcttgtgtgggtacctgtgctcctggcctggtcgtgtagaagagtagcagg
cagtggaagcccccagcagccttgggtgacggggtgggatgtcccgctccctctccccca
agtctacttcaacaaggttgtggggaggcaaagccacaccccaagtaccttgactgcact
EXON 6  130 bp
tcctggcctggtcgtgtagaagagtagcaggcagtggaagcccccagcagccttgggtga
cggggtgggatgtcccgctccctctcccccaagtctacttcaacaaggttgtggggaggc
aaagccacaccccaagtaccttgactgcactgcacagggtgactctgccctttcctccag
GAGAGAGCCTTGAACTCTGCCAGCACCTCGCTTCCCACAAGCTGTCCAGGCAGTGAGCCA
GTGCCCACCCATCAGCAGGGGCAGCCTGCCTTGGAGCTGAAAGAGGAGAGCTTCAGAGAC
CCCGCTGAGG
gtacgttgcctggcacagacgtcacacacagtctgcccggaggggatcccgtgagcactt
gggcagctcgagacacctgcatcatcggcaggtggtcatttcgcaggcagttgggtccct
tgactttgaatgactcatgcacaaacttgtggtttgtcaaaacttagtcagtgttaggag
EXON 7  53 bp
cggtgcccaggaggcgcctgccgcagacagcagtcaggccccgaacatccacacctccaa
gggaggaaatactgctggctggaatgatcctgcctcactgagtgctgagggagacaccag
cccgccgcccttagggccctggtgaggggcgatggcggcggcatgattcactcctctcag
TTCTAGGCACGGGCGCGGAGGTGGATTACCTGGAGCAGTTTGGAACTTCCTCG
gtaggtaccaggcaattccgcgaagcctcacccacagggtgtccgagagcagccacggca
ggtcttgcccccggagcgtcccttggtgcccacgtccccccagctgcacacaggcccagg
cattgtggcgggctgtgaatccagggccccttctgcagcacctcctctaagtggtgtcct
EXON 8  104 bp
aaactctgacacgctgtgctgctgggaatggtggtgtctcgggcagggttgtgggtgacc
gggggtgggagtgtgcgggtgaccgggggtgggagtgtgcaggtgacctccctggccctt
agcccccgtgtgtgttaggggatggcagtcagacctgatcacttgccctcttgtccccag
TTTAAGGAGTCGGCCTTGAGGAAGCAGTCCTTATACCTCAAGTTCGACCCCCTCCTGAGG
GACAGTCCTGGTAGACCAGTGCCCGTGGCCACCGAGACCAGCAG
gtatgtgcgccggccctccctcatgcatgaagccttgagtgtgggaagactggaggctgt
tcctaggtgtgctgtctgcacagaggcttctagaccggggggagatgatcagaactggaa
aggagctgtgctaggggtgggctgggcagcaaggccagagcagcccttgtgtgtctggca
EXON 9  88 bp
cacggagcagcagagaggccgggcatgctggatgcgggtctgcgttttctaccactaccc
tgacttgagtggttttaaactaaaaagcaaagagcccggttagcttgtccacatggtcct
ctgtgtcctactcaacactgggagggcctagtgactgaggctgcctctgcttggtggcag
CATGCACGGTGCAAATGAGACTCCCTCAGGACGTCCGCGGGAAGCCAAGCTTGTGGAGTT
CGATTTCTTGGGAGCACTGGACATTCCT
gtaagtccttgagtccctcttgaactgtcttgtgtgtggtctgagggaacgagttgtttt
aagggcctatattttctattcctgggggtctgagcctttggttttgttgggggcatgggg
ccgctgtgctgttccctcgccgcactgtctcgggtccctcatgcactgtctgaggctctt
EXON 10  105 bp
ctgagcctttggttttgttgggggcatggggccgctgtgctgttccctcgccgcactgtc
tcgggtccctcatgcactgtctgaggctcttggcctgtgtgggcctttcctccctcacac
taggtcagaggtaagaggcaagggcgaaatgggttcctgtttcatccccatctcccgcag
GTGCCAGGCCCACCCCCAGGTGTTCCCGCGCCTGGGGGCCCACCCCTGTCCACCGGACCT
ATAGTGGACCTGCTCCAGTACAGCCAGAAGGACCTGGATGCAGTG
gtaaggacgcaggtagtagctattccacagaacctgcaggccgctctggggcttggccaa
cagtgggcaggggtccaacagcctgacccgccatccctgccatccctgcccctgctggtt
ggggtggaattgcagagagctgccggcccctggcctgtcactactgcccaggtcgctgag
EXON 11  77 bp
ggagcaggtggccttggcctcgacagggttcccagggtcccactggaagccccacatgga
actgtgcctctgggacattgctccagggacctcgggtgcgggctggccccatcctgtggg
gaggtcctgggagggtcagtctggcccgcctgcctgctgacttgggtgtggcctgagcag
GTAAAGGCGACACAGGAGGAGAACCGGGAGCTGAGGAGCAGGTGTGAGGAGCTCCACGGG
AAGAACCTGGAACTGGG
gtaaggaggccccgtctcctgtcctccccgtccccatccccctcgccatccttgtcccca
tccccctcgccatccttgtccccatccccctcgccatccctgtccccgtccccatcccca
cctggcctgggaccgctgggcacccgaggcaatggctgtgtgtctgttctcctcccacag
EXON 12  44 bp
gtaaggaggccccgtctcctgtcctccccgtccccatccccctcgccatccttgtcccca
tccccctcgccatccttgtccccatccccctcgccatccctgtccccgtccccatcccca
cctggcctgggaccgctgggcacccgaggcaatggctgtgtgtctgttctcctcccacag
GAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGG
gtgagtgcccgggccaccgaggccacgtgcctccacgaggggctgcctatgccccaccct
ggccctgccctgcaccctgcctaggaccccaccctcctgaggccccttttcctaacacac
gagtcccttcaacatgggcccggccgtggaagcactgaggcgagttgcggggaagctggt
EXON 13  161 bp
gggctttgcatccggcctagaagatcctgggtggagggacccatcaccctccgaggctca
cacccactgcccacctctcctcctggcgctcgagtcccttgcctcattccttgggctgtc
tctggcacccatcgtttcggttgcctcctcatcctgaacgtttgcttttcttttctcaag
AGGAAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGAAA
AAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGC
GTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAG
gtatgtctccgccaccctggtgtcctcacctcggaggctgatggactcatggtccaagcc
agcggggctacaagctgctgtctttgcaccttggtccttggccaagcctccccttgccac
gggggcatgggatgacctgtgaacgagacagggtgcaggagtcacagcatagctggtttg
EXON 14  107 bp
tccagagggggtgagctgggaacttgtgtgaaggggctttttccaaaaggaaaacgggag
ctactggctcacggctgatgccccagacagcctcgaggatctgcaggtccccagacacca
agcctgggtgctctccagcagacggcgtggtacccacagctaatgcctgccccttcctag
AACGAAGAGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGC
CAGAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCT
gtgagtgctgggcgaggccccaccctggagggagaatctgagcacctgggccccagctca
gcctctgccccgcccctacccctccagggcaaacgaggagatcgcccaggtccggagcaa
ggcccaggcggaagcgttggccctccaggccagcctgaggaaggagcagatgcgcatcca
EXON 15  121 bp
gaagaagtgcgtggaggattacctggcaaggatcacccaggagggccagaggtaccaagc
cctgaaggcccacgcggaggagaagctgcagctgtgagtgctgggcgaggccccaccctg
gagggagaatctgagcacctgggccccagctcagcctctgccccgcccctacccctccag
GGCAAACGAGGAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCA
GGCCAGCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAA
G
gtgggtgcgggaagcccagctcaaggggccgtctggcagcaccttctagaaggcccttgg
gcctgctgctccctccaagcagggagaagccccgcaactcatcttcctcctccagactaa
agagaacgaggagctgaccaggatctgcgacgacctcatctccaagatggagaagatctg
EXON 16  221 bp
tccaggccagcctgaggaaggagcagatgcgcatccagtcgctggagaagacagtggagc
agaaggtgggtgcgggaagcccagctcaaggggccgtctggcagcaccttctagaaggcc
cttgggcctgctgctccctccaagcagggagaagccccgcaactcatcttcctcctccag
ACTAAAGAGAACGAGGAGCTGACCAGGATCTGCGACGACCTCATCTCCAAGATGGAGAAG
ATCTGACCTCCACGGAGCCGCTGTCCCCGCCCCCCTGCTCCCGTCTGTCTGTCCTGTCTG
ATTCTCTTAGGTGTCATGTTCTTTTTTCTGTCTTGTCTTCAACTTTTTTAAAAACTAGAT
TGCTTTGAAAACATGACTCAATAAAAGTTTCCTTTCAATTT
aaacactgaagccgctctggtcttgatgaagcaaaggtttcccagctctagcctgaggct
gagccgacccgcaggtgccctcccttcccctcagagctggccacttggtccctgcctacc
ccaggctcaggccaccctgccgaggggcagggacagccagtggatagaggaggctcaggc