Gene LETM1 Variant 1
DNA : 43.21 KbNT_037623
mRNA : 3908 bp NM_012318
CDS : 2220 bp NP_036450
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  379 bp
cacgctgcgagccccggcgtccacggtacgacgggaaccaggatgcagcgagccccagga
gccagccgccccggtgcacgccgggaccggtagtccgcgcctcagggtagtccgccgctc
cggtgcacgccgggatcggtagtccgcaccccagcgtgcaggccgtcccggtgcacgccg
GAACCGGTAGTCCGCGGTGGCGCGGTCCGCCCCTCACCTGGCCAGCGGCGGGCGCTGAGG
GGCCCAATGGGAGCCGCGGCCTGGCCGCCCCGCCCCGCGCCTCCGGACGTCTGTGCCGGG
ACAAGGCCGCCGCTGGTGCCGGGTCCTTGAGGAGAGCGCCTCCCGTCCGAGGCCAGCCGC
CTCTGTCAGCCGTCCGCGCGGGCCGGGTCTGAAGCGCCGCCGGGACGGCGAAGAGCCGCG
GCCGCCGCGGAGAAGGAGGCAGCGCAGGAGGCCGGAGCGGCCGCCGCGCCCGAGCACATG
GCGTCCATCTTACTGAGGAGCTGCCGCGGCCGGGCGCCCGCCCGCCTCCCGCCGCCGCCT
CGGTACACCGTCCCGCGGG
gtaagcggcgggcaccccagggcggggccggctcccggctggtgggtcgggagcgcggac
gacccgcgggttcgggctggttgtcacggcgatgcggggagcccggtggtcccggcctcc
ggagcccctgcgggaccgtggggccccgggtctcgtcgcgggctgggccgccagcgccgg
EXON 2  61 bp
aggaggctgaggcaggagaatcaattaaacccaggaggtggaggttgcagtgagccgaga
tcacgccattgcactctagcctgggcgcaagagcgaaactccaaaaaccaacaacaaaaa
aaggtatcagtataaatccctgatttactactcatttattttcccctgttcctgttacag
GTAGTCCAGGGGATCCTGCTCATCTCAGCTGTGCCAGCACCCTGGGGTTGAGGAACTGCC
T
gtgagtaaatcagtatcactctgcacctgtctgtttgaaaacagggtttgaaaatggtgg
agagtcacgagtgactcttgatttttgagggaaacagtgtatcctactttcctgttcttt
gtttcttttaaacctttatctttccattttgaaaatgattgtcacatgcctcagtgaatc
EXON 3  451 bp
tcccttccgaagggctccccagcgggcagtgcaaaacgtcaggaagtaggtgggattgtg
tgtggttgtgacatggcatggcacggggcatgtgggttttgctgctgttggtgttcggtg
ctgagctgtcaaaggctagtgctggctcttactactgttttccactcttcccttttcaag
GAATGTTCCATTTGGCTGCTGCACTCCCATCCACCCTGTGTACACATCCTCCAGAGGCGA
TCACCTCGGCTGTTGGGCTCTGAGGCCCGAGTGCCTTCGCATAGTGTCGAGAGCGCCATG
GACCTCTACCTCTGTGGGTTTTGTGGCTGTGGGACCTCAGTGCCTTCCTGTGCGTGGCTG
GCACTCTTCGCGCCCTGTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAA
GGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGT
GGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTT
CCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGG
CCACAGCCTGACCCGCCGGGAGCGCAGGCAG
gtaatggggacatgtctagtcctttcttttctttcttgctctatcacccaggctggagtg
cagtggcgcaatttcctgggcatgggcgatcctcctgcctcagcctcccgagtatctggg
accacaggcatgtgccaccacacctggctaattgttttttatagatccagggtcccactt
EXON 4  144 bp
gaaagaagtgggttttgggaatggtctgctaagtggttctggaacttagagtcctcagtg
ggtcctgtgagtcgctgcctgaggttgtgcctataaaccattataggagaaatgctcaca
ccccttgcccttgttcccacatgtgctctgctcccctctgatggattccgccccttccag
TTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTG
CCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCC
ACATTTGAGACTCAGTCACTCAAG
gtaagggcagcatcccaactgcttgttttagaatgagtctgaaattcattgtgatggctt
ccttgtttgtgacttttcaggtgctagatatttttgagactttatgtatcttcatattgt
ccttgtgctgtgcaataattatttagtggatgctgggttttggatttgtttctctttatt
EXON 5  138 bp
cacacgggtactttttaaaaccatgaaataaaagagtttgagaatgtattgcacttagat
gagagtcagtgtgttgtgaaatgtttctgggagtgggggtcgggcacaggcgtgagatgt
tttccttgcccgaaccacagtctgagcagttggaatgcagtgccctctctgcccttgcag
GAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGAC
ACCATCGAGGAGATGGCCTTGAAGAACAAGGCAGCCAAGGGCAGCGCCACCAAAGACTTC
TCTGTGTTTTTCCAGAAG
gtgctgtgatacgtctgagtccctgtgacctcaccagggagccttccctgattttctgtt
tccctttcgctgtgctcagcagagtggagctcccccaggtgctggctggcgcttgaaagt
ttacccaggaggctcagtcgggggccagtggagtgtcaggagtctgcccccacgagctcc
EXON 6  204 bp
tgcattccagcctgggtaacagagcgagaccctgtctcaaacaaaaaaaaaaaagaagaa
gtagtcagtggtttgagtccctgaggatgagaggcagcaccctttgggaatgtggttggt
cgtgggagggagccgggtgggcgcgtgtcccggggatgacccttgtgaccacttccgcag
ATCCGGGAAACAGGGGAGAGGCCCAGCAATGAGGAAATCATGCGTTTTTCCAAATTATTT
GAGGATGAGCTGACCCTGGACAACCTGACACGGCCGCAGCTGGTGGCCCTGTGCAAGCTG
CTGGAGCTACAGTCCATCGGCACCAACAACTTCCTGCGCTTCCAGCTTACCATGCGGCTG
CGCTCCATAAAGGCAGACGACAAG
gtgagcctggccatactccgcgccacagctctggtgttttaccttttcgtttcctgatga
taaaagcagcatgtcctcattgtagaaactctggaagatgctgaacgatcgaaaataagc
tcactaggagtcttgccacttgcagattgcagatcctttgaagatggatgtcttttctct
EXON 7  120 bp
agatcctgaccctccgtcacaggcttccagtcacttctaacctagaactgggctttggtg
gccgtggtttgattcttgcttggcaaaatctgttagccacttattctggagggtgttcac
acagacactgtcacccaccagcaactgtcccagatgataattcactgctttgttttctag
CTGATTGCTGAGGAAGGGGTGGACAGCCTGAATGTCAAGGAGCTGCAGGCAGCGTGTCGG
GCACGAGGCATGCGGGCCCTGGGCGTCACGGAAGACCGCCTGAGGGGTCAGCTGAAGCAG

gtgcgtgaatattggcctggtgccaggccggcacgggctcaagggaaacatcagcctcga
aaggccactcggaggctcttcccaaactctgggccggcctggcgaggcgacactgtgacc
tctctggggacggccaggatgtttgggctgtttctcgcccttctgctcctaccgcactca
EXON 8  132 bp
ctctggtgttttgtttactaacgccgtcatcgggtcacgcagcacagcaacaaacagacc
ttgtagaacttgagacactgtcttctctgagagctattctggtgatgagatgggcggacc
tgctgtggggccagcagggttggggggctgcccatctgctgaacctggccttggttgcag
TGGCTGGACCTGCACCTGCATCAGGAGATCCCCACATCGCTGCTCATCCTGTCCCGGGCC
ATGTACCTCCCGGACACCCTCTCTCCAGCCGACCAGCTCAAGTCCACACTGCAGACCCTC
CCAGAGATTGTG
gtacgtgctgtcggagaccccttttacctcatctcttcataggtggctccgctcttctgg
ggtggggggaggtgtgcaagcgcactcattcctcaaccatgggcgaggagcctgcctccc
accccctcgcgagtgcccccacccagccacctgtccccttccttccatccctcctcacca
EXON 9  144 bp
gagggcggcccaggggcctcccagcaattgcgggcagcacctcggcagtgccttctgtcc
tgtgtgtgtgaagcccaggtggtgacggggcaggggacacaggacacaggacagaggtga
ggggcagcaggggcctctggtggcttctgggctcacccacagatgtaccctcttctgaag
GCAAAGGAAGCACAGGTGAAAGTGGCCGAGGTGGAGGGCGAGCAGGTGGACAACAAGGCC
AAGCTGGAGGCCACGCTGCAGGAGGAGGCGGCCATCCAGCAGGAGCACCGTGAGAAGGAG
CTGCAGAAGCGCTCGGAGGTGGCG
gtaagcggtggtcctgctccgtgccgcgtggggctgtcctgagccagcctccctagaaac
ccccgcacgcccacagtcttggcctcccgcatgcttgccctgcagctctgtcctgcatgt
ttatttcctcctggagtggtcagggaggcagggtgcccgggtgtgagggctgcaactctg
EXON 10  132 bp
caggtgacctggcagctgcatggagcctccctagggaccttctgtggcaggtgtgctgcc
caatgtcacctgcaggcctgctcccagtgtggcctctgccatatgttctgagcttcgggg
agcaagaagactgcttctgtgtgatggcgggcgctgggctggtgtcgccttgcctttcag
AAGGATTTTGAGCCCGAACGTGTGGTAGCTGCTCCCCAAAGGCCGGGGACCGAGCCACAG
CCAGAAATGCCTGACACAGTCCTGCAGTCAGAGACCTTGAAGGACACTGCCCCGGTGCTG
GAGGGCTTGAAG
gtaatgaggcaggttctggggccctggaggctgaggagggcatggcctggctttgtggac
agttgtggggcagggatggggacaggttagctggggcatctatagccctcagtgagagga
gatggtgcaaggggttgaggatgaggccactgggcccctaggaggcttggtggttaggaa
EXON 11  135 bp
cgtgcagcagccagcgcagcagtgaacctgaaccccgcgggtctcttgttaccaatgact
gtccagtgagactcttgccctgggctgcccgtataatatgaacagagcagctggtcactt
gggaacaggccagttctttcccttggctcaggctttgttgtttgcccatttttatcccag
GAGGAAGAGATCACGAAGGAGGAAATCGACATCCTCAGCGATGCCTGCTCTAAGCTGCAG
GAGCAGAAGAAGTCACTCACCAAGGAGAAGGAGGAGCTGGAGCTGCTGAAGGAGGATGTG
CAGGACTACAGCGAG
gtgggtgggatttgctccctggactctgagactgcaagaagagtaaaatcgctgtactgg
ccccaaaagtatacataatacttccgtcagatacttgataagctggccaaagagtatttg
gagaggaaagcacgttataaataaaccttattcagtaacctttccacagccattccggct
EXON 12  188 bp
tttgtatttttagtagaggcggggtttcaccacattggccaggctggtctcgaactccta
acctcaggtgatccgcccgccttggccttgcaaagtactgggattacaggcgtgagccac
tacacctgaccccctttttcttttaagacaaactttttacaaccaaaataattttattag
GACTTGCAGGAGATCAAGAAGGAACTTTCAAAGACTGGTGAAGAAAAGTACGTGGAAGAA
TCTAAAGCCAGCAAGAGATTGACAAAAAGGGTGCAGCAAATGATCGGGCAGATCGATGGC
TTGATCTCGCAGCTGGAGATGGACCAGCAGGCTGGCAAGCTGGCCCCGGCCAACGGCATG
CCCACGGG
gtgagtggggtggtgggcgcgggagagggatcggagactcacatagggaggctggtccct
ttgctggatccgagctgggcccttctggctccaaagggcacattgtagcctctgcctggc
tgcctctccacctttgaccagcagtcccagccaggaaccctctggcatgtcagtctctgc
EXON 13  139 bp
gggagctcttggcattgtatgcaggatgggatcataccttgggggtccgtgctggaggtt
gcctggctcacgcggagccgcctgtgtcagtgctgaccacttgcagccacaggtgtgggc
agtgaggccctgtgtggcaggacgcctgcccgtggccacatgcaggctgtgcttccacag
GGAGAACGTCATCAGTGTCGCTGAGCTCATCAACGCCATGAAGCAAGTCAAGCACATTCC
CGAAAGCAAGCTCACCAGCCTGGCCGCAGCACTGGATGAAAACAAGGATGGCAAGGTCAA
CATCGACGACCTCGTCAAG
gtgggcctcgctggggaccacgcaggccatccgccacctgctctggagtggggtggggca
gggggactgttcattgcatgtccggcaccctcctgggcagctaccccctcctgtcagggg
tttgggtctgtcactgcgactgctcctttaagccgctgctctcatttgaaacatcagaag
EXON 14  1541 bp
ccagggtctgtggcaccccttgggggaattggtgctctgaggaccctggggcccgcaggc
agtgattgcgtgcatgctgctgccaccccagctggggcgactgacggcgctggccccgcc
tctgcctcactgtgctgtagggcgcagccacctgagcctctccctttcccacgtgtgtag
GTGATTGAGCTGGTGGACAAAGAAGATGTTCACATCTCCACCAGCCAGGTGGCTGAGATT
GTAGCAACACTGGAAAAAGAGGAGAAGGTGGAGGAGAAGGAGAAGGCCAAAGAGAAGGCA
GAGAAGGAGGTCGCAGAGGTGAAGAGCTAGAACCACTGGCCTGGGCACCTGTCCTCCTGC
TGTGCCGTCACCCTGGCAAGGGCCGTGAGGGCGATTGCTTTGTGGTGATTCTCAGTGGCT
CATCTAATATTTTGGCTGGAATAAATCAGAGACTTCCATAATCAAGTAAATTTTAATTTT
CATCATTCCACGGAGATTCAGTCTGTCTGGAATCCCGGAACCCCTCCACAGAATCGTGTC
TGGATCCACACTGTGGTGTGGCTGCCACGGCCTCCTGGCTCCAGAGGCAGCTGGGCTGGG
CCAAGGCAGGAAGGCGCCCCCATGTGTGTGGCCTCAGTCTCAGCATCTGACTGTGCTGCC
CTGTCCCCAGGGAAGAGAATGAGGACCACGTGGACTCCGCCCACACAGAGCTGGCTGCTG
TGCCCACCCTCAGGGGCGTCAGGAGACACAGCCTGGCCTCCTCAGGGCTGAAGATGCCTC
CATTCGCCTGTGGACCTTGATTTCTAGATTTCAGTGTCAATAGACCTGTCTTCCTGCACA
CTTTCAGTTGGATGTGGGTCATTGTGGAGACAGAGGTGTCTGCCATCTCTGTGGCCTCTG
GAGAGTGACGTCTCCCTGCTGGGAGTGCTGGTTCTCACGTGCGGTTTCCCTTGTGTATCG
GAGCTCTTTCTCGGCTTTCTATTTCCCCCAGTTCTTTAAGCAGTCAATTGGCACAGAGTT
TCCCACGGGGGCTGCAGTGGATTCACTGTGTCAGGGATGAGCCTGGCTTGGGGGTTGGTG
GGGCTCTGAAGCGCATTTGGGGTTCTTTGTAGCTTCTAATGTGAGGTTTGAGTCCAGTGC
GCCCACAGCAGCATGCCCTTCTCACCCCTTGCAGTGTTGCAGGCTCAGGCCCCTGGGCTC
CTTCAGCAAGCAGGCTAGTCAATGAGGCATGAGGATCCGGCACAGGGCATCCCCTGGGGC
TTCAAGGGCAATACCCCCGTGCTTAGGGTTTGCCCTGTGCCCTCTGGGTGGGGTGGCCTC
CCCGCACTCGGCAGCATGGCCAGGCTGGCCAGGGCGTGGGCAGGTGGTGTCCTGTGGCAC
CTCCATCCTCCTGCCCAGCCGGCTGTGTCACACTCATCTTTTTAAGGTCAGGTTGGTTCC
TGGCAAAAATGTACCTCCAGGGGCCTCCAAGCATAGGATTTGGAAGACAGGAACGGCACA
GGCGTCCAGGAAAGCAGCTGCACTCAGACAATGCCTTCTCCATTACTTGAAGCTTCTTTC
TGTTCAGCCATTAAAGAAACTTGACAAAATAGGAACAGGAGATATTTCTCAATTGTAAAC
CTTTGTGCAGGGACAGTTGGCTTCCAGAGGCTTTCAGCTTTCAGTTATTTGAGAAGTTTG
TTTTAGATCCTTAACTAATATTTATGAATTCTCTCACCCTG
tgtaagtagcctggtgttcgtttgtccaagtgtacttacccttgagaacaagtcttgcag
ttgccaggtgtgtgcagacgcctctcctgtgagcggcatcgcgggcccagtcagctgccc
cggctctcatcctcgtcctcactgccttggctgagcactgttgacgtgaacagccactgc