Gene IL21 Variant 1
DNA : 8.43 KbNT_016354
mRNA : 617 bp NM_021803
CDS : 489 bp NP_068575
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  214 bp
catcaatccctgcccccacacattagcacatgcacacgtatacctagccagtggaaaaga
aaaaagagttactcacattcatccattttacaaagatttccaggctgcaatgggagggct
ttacctctccctgaaggatgaataaataggtagcttaactgacaacctgttctcagtcaa
GCTGAAGTGAAAACGAGACCAAGGTCTAGCTCTACTGTTGGTACTTATGAGATCCAGTCC
TGGCAACATGGAGAGGATTGTCATCTGTCTGATGGTCATCTTCTTGGGGACACTGGTCCA
CAAATCAAGCTCCCAAGGTCAAGATCGCCACATGATTAGAATGCGTCAACTTATAGATAT
TGTTGATCAGCTGAAAAATTATGTGAATGACTTG
gtaagactatatttgtcacaacaaaatctaaatcatacttttcaattaatataaaaggag
ggtttggcttataaaaataactcagaacaaattttcttttgctctaggtccctgaatttc
tgccagctccagaagatgtagaggtaagaccagttgaatttatttctgaaaatacattgg
EXON 2  36 bp
agatcgccacatgattagaatgcgtcaacttatagatattgttgatcagctgaaaaatta
tgtgaatgacttggtaagactatatttgtcacaacaaaatctaaatcatacttttcaatt
aatataaaaggagggtttggcttataaaaataactcagaacaaattttcttttgctctag
GTCCCTGAATTTCTGCCAGCTCCAGAAGATGTAGAG
gtaagaccagttgaatttatttctgaaaatacattggacataagtttttaaatccaataa
gaaagacattagcatgattatataggagtatactgaattttaatgaacttagcggtctaa
taattgatgaaatatttatttatattttggttaaattcattgatttaccaaaaaccaact
EXON 3  156 bp
gggattgtccctttttcccatcccaaagattaagtaggaggtgaaatcatacctcactca
tctgttgaaacgatgtaatgcacgacattgcagaagagatagaaatagaggattgggaaa
gctatcttttactttctgaataatgtttgttaacatatatacaaattgtttatctttcag
ACAAACTGTGAGTGGTCAGCTTTTTCCTGCTTTCAGAAGGCCCAACTAAAGTCAGCAAAT
ACAGGAAACAATGAAAGGATAATCAATGTATCAATTAAAAAGCTGAAGAGGAAACCACCT
TCCACAAATGCAGGGAGAAGACAGAAACACAGACTA
gtaagattgtcatttgtcatctctcttatttgtacttataaactatatatcttgcattac
ataaacatacacacacacctgtagccagggctgctggtgtcttccttacctatagttatg
ccttattatacatggtgcttttttttttttttttaagacagagtctcactctgtcaccca
EXON 4  78 bp
ctatctctgggaatgggattacaaggactttttccattgttactttccaaacagttttat
gtacttctcgaatgtttttcagtgaacataatttatgtttttaatgaaaaaaaattttaa
gaaacattttattacgaaaaaaattttaaagaagactgttactttttcattgatttctag
ACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAAAGATTC
AAATCACTTCTCCAAAAG
gtatctaccttaagtttcatttgattttctgctttatctttacctatccagatttgcttc
ttagttactcacggtatactatttccacagatgattcatcagcatctgtcctctagaaca
cacggaagtgaagattcctgaggatctaacttgcagttggacactatgttacatactcta
EXON 5  133 bp
attgatttctagacatgcccttcatgtgattcttatgagaaaaaaccacccaaagaattc
ctagaaagattcaaatcacttctccaaaaggtatctaccttaagtttcatttgattttct
gctttatctttacctatccagatttgcttcttagttactcacggtatactatttccacag
ATGATTCATCAGCATCTGTCCTCTAGAACACACGGAAGTGAAGATTCCTGAGGATCTAAC
TTGCAGTTGGACACTATGTTACATACTCTAATATAGTAGTGAAAGTCATTTCTTTGTATT
CCAAGTGGAGGAG
tacaatatattagcgatgggaaaaaaaaactcataagtgtgcaaagtcaggattatttcc
ccataatcactatacaatagtctgatttcctatgttattgatttctatgacttctgaagt
ttttactttatctcactgcccaactttgacatttcttggttgaaggagaaggctaaaatt