Gene GPR78 Variant 1
DNA : 6.38 KbNT_006307
mRNA : 1092 bp NM_080819
CDS : 1092 bp NP_543009
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  668 bp
tgccccggaccctgcacttgccgccgctttcctcgcgctgctctggaccttgctagccgg
ctctgcacctcccagaagccgtgggcgcgccgctcagctgctccatcgcctcactttccc
aggctcgcgcccgaagcagagccatgagaaccccagggtgcctggcgagccgctagcgcc
ATGGGCCCCGGCGAGGCGCTGCTGGCGGGTCTCCTGGTGATGGTACTGGCCGTGGCGCTG
CTATCCAACGCACTGGTGCTGCTTTGTTGCGCCTACAGCGCTGAGCTCCGCACTCGAGCC
TCAGGCGTCCTCCTGGTGAATCTGTCTCTGGGCCACCTGCTGCTGGCGGCGCTGGACATG
CCCTTCACGCTGCTCGGTGTGATGCGCGGGCGGACACCGTCGGCGCCCGGCGCATGCCAA
GTCATTGGCTTCCTGGACACCTTCCTGGCGTCCAACGCGGCGCTGAGCGTGGCGGCGCTG
AGCGCAGACCAGTGGCTGGCAGTGGGCTTCCCACTGCGCTACGCCGGACGCCTGCGACCG
CGCTATGCCGGCCTGCTGCTGGGCTGTGCCTGGGGACAGTCGCTGGCCTTCTCAGGCGCT
GCACTTGGCTGCTCGTGGCTTGGCTACAGCAGCGCCTTCGCGTCCTGTTCGCTGCGCCTG
CCGCCCGAGCCTGAGCGTCCGCGCTTCGCAGCCTTCACCGCCACGCTCCATGCCGTGGGC
TTCGTGCTGCCGCTGGCGGTGCTCTGCCTCACCTCGCTCCAGGTGCACCGGGTGGCACGC
AGACACTGCCAGCGCATGGACACCGTCACCATGAAGGCGCTCGCGCTGCTCGCCGACCTG
CACCCCAG
gtattggcccagtgcatgccgacaggcccaggccagggacttgggcgctccctgggcagt
tggcttgaggagcctgtgggcatcaccaccgttactccgcccagagttcaccagccacag
cactgcccctgcacgctgctcacaggggtttcctgttggttcattggtgcagacactgcg
EXON 2  114 bp
caaaaaagcaagcctaccccttgttctttctctctcccccatccctctgtcctcctcagg
ttccaggctaaacatcctcctgaaaccctcctgtctgccctcacttcagcccctgggctc
tgggcctgggttctgtccccaccctgccatcatcctgaccactgtcctctgtccccacag
TGTGCGGCAGCGCTGCCTCATCCAGCAGAAGCGGCGCCGCCACCGCGCCACCAGGAAGAT
TGGCATTGCTATTGCGACCTTCCTCATCTGCTTTGCCCCGTATGTCATGACCAG
gtgggtcctggcagtccggctcctgttgtgggaacagctgggtgggcttggcctcagttg
agtaggcctctgaggtttcccagcaagatatctggagggcggccaccaccagaggaccct
cctccacacctgacgggctcagggctgtgcttcagctcctgggaaagatcctgggaggga
EXON 3  310 bp
tgtaatcccattttaggaagaggagcccaaggctcagggtgctggtgcagagccccctgg
ctagtgagcatcagggctgcggtacgtacttgagtatggttctagcaccttcccccggag
cgtgagtgcgtggcaggtgctgtcactgtggctgagttagctgctccgcttccccaacag
GCTGGCGGAGCTCGTGCCCTTCGTCACCGTGAACGCCCAGTGGGGCATCCTCAGCAAGTG
CCTGACCTACAGCAAGGCGGTGGCCGACCCGTTCACGTACTCTCTGCTCCGCCGGCCGTT
CCGCCAAGTCCTGGCCGGCATGGTGCACCGGCTGCTGAAGAGAACCCCGCGCCCAGCATC
CACCCATGACAGCTCTCTGGATGTGGCCGGCATGGTGCACCAGCTGCTGAAGAGAACCCC
GCACCCAGCGTCCACCCACAACGGCTCTGTGGACACAGAGAATGATTCCTGCCTGCAGCA
GACACACTGA
gggcctggcagggctcatcgcccccaccttctaagaagccctgtggaaagggcactggcc
ctgctacagagatgccactggggacccccagacaccagtggcttgactttgagctgaggc
tgaagtacaggaggaggaggaggagagggctggatgtgggtgtggacagcaggagtggcg