Gene ETFDH Variant 1
DNA : 36.32 KbNT_016606
mRNA : 2106 bp NM_004453
CDS : 1854 bp NP_004444
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  147 bp
ctgtttcaccgctccccggctgggacttggagtcccttatctttccctggtttggtacat
gacccggaagcctcggctggccgttgcgtcatccatggcgccggcgcagagcgagaagga
ggtgggaacgccgtgaagcaagagcggtcggcagagcggggaggcgaactgcagcagagt
TCTTGCTTTCCGGCAGGTGATGGCGCCCCCCGCGGCCTAGAGGTCCAGCGCCCGCCGCGA
GCAGCGGACAGTCCTCCTGTTGTGTCCGACCGAGAGTCCTGGTGACTTTGAACATGCTGG
TGCCGCTAGCCAAGCTGTCCTGCCTGG
gtgagaggaaacgggcggtggggataagtggaggagttagggcaaaagggacaaggccgg
tcctgggggctgtaggcacctctcgccccttctctcatcagctttctcaggctatctagg
gcaaaggtcacgcgctgtcagcctgttgggggaccctggcttcctccctctggggttgcc
EXON 2  141 bp
aaaatatttaagatttgaaaacattgctttatgagaaaaagctattcaaagtgttcacct
aggaaagattatagtatatttcactatactcattgagtatagtcattcacttatattttt
tcagtctactgaggaaaactaattttaaggaagataataattttcgtaatttttgtgcag
CATATCAGTGCTTTCATGCCTTAAAAATTAAGAAAAATTATCTACCTCTATGTGCTACAA
GATGGTCTTCAACTTCTACTGTGCCTCGAATTACTACCCATTATACTATTTATCCCCGGG
ATAAGGACAAGAGATGGGAAG
gtaagtaataatttgtgtacaattcctgagacttttctggatactttgttttcattttgt
ggaggagagtattaatatttttcataatttaaaaacatctaataatattttgtggcttta
ccaagtcacatgctgcataatgacccttcagtcaacaacacgacaattataatggtaatc
EXON 3  230 bp
acagaacctaagaatataatcatactaatacagtaatatgcttaatataattattgtgca
aaacacagggagaatttccataaataatactctaaagcacagtggatattttttaactgt
catgtgatttatcatgtgattattgggttatattaatcccagaatttttatttctcccag
GAGTGAACATGGAAAGGTTTGCAGAAGAAGCAGATGTTGTAATAGTTGGTGCAGGCCCTG
CAGGGCTCTCTGCAGCTGTTCGTCTAAAACAGTTGGCTGTGGCACATGAAAAGGACATCC
GTGTGTGTCTAGTGGAGAAAGCTGCCCAGATAGGAGCTCATACTCTCTCAGGGGCTTGCC
TTGATCCAGGTGCTTTTAAAGAACTCTTCCCAGACTGGAAAGAGAAGGGG
gtatgaaaaattgttttttatacaaagtctaatcttttgtaattgtatttcagtaattgt
tcccaaattactggaatataggaaacccttttcatgtaactctatcttttttttttttct
ttttttgagatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatcttgg
EXON 4  82 bp
tctgtacatctcagacagagaaaggattcacagtgacaagttttataaaggaaatgccaa
aagaaaattaggggggagttctttttttgtcatcagagtacattttatagtttttttgta
tttatatttacacttgcaaatataaactaaaaacatttctttttcttcttttatttctag
GCTCCACTTAACACTCCTGTAACAGAAGACAGATTTGGAATTTTAACAGAGAAATACAGA
ATTCCTGTGCCAATTCTTCCAG
gtaaggtatagtgaatatgcatagaactatggaattccacagctggaaggaactacattt
catctgacgaaatttcctccttttacagacaagaactgagacccagatatttgaaggact
tactcaaagctatacagctagctggtgggaaagcaggactagaactcagttcttttgtct
EXON 5  119 bp
tgtttgtaatgtaataaattagaactctagaccaaaattgtagaaaataagttgaaagtg
tgaccatcaatgtagcacttatgtagaaatacatattgattcgaaattttaaagtattta
tgtttttgtaatgtcttatcaataaaaagtcagatttataaattaagcatatatttatag
GGCTTCCAATGAATAATCATGGCAATTACATTGTACGCTTGGGACATTTAGTGAGCTGGA
TGGGCGAACAAGCAGAAGCCCTTGGTGTTGAAGTATACCCTGGTTATGCAGCTGCTGAG
gtttgtatagttttgttttgttttaatatttataggaactctctttttttaataagtgga
gaattttataaagttgaagaaataaatattttttaaaagccatgggattttagaattata
agattagaaggaatctttaaagtatctaatccaaagagtacttgaattcctcatgttgta
EXON 6  78 bp
aatactctggaagggagtaccttaatacatgtctctttattacctgaacattttaaactc
tgtatttctataatctagagaagatgttcaccttctaagaaacctaaggctgtttactgt
ttttttcaagattattatgaattctaaggtattaataaatttgttttttatcatttttag
GTCCTTTTTCATGATGATGGTAGTGTAAAAGGAATTGCCACTAACGATGTAGGGATACAA
AAGGATGGTGCACCAAAG
gtaaacctttttaatagttacgtgcttaataaagcgacaaacaacagaaagaactgtgtg
ggcatcaaagtgaaaccccatctctccaaaaaaagaaaacaaaattagctgggcttcgtg
gtatacacctgtagtcctagctactttggaggctgaaacaggaggatcacttgagcccag
EXON 7  147 bp
gtgagaagagtaagattatatgattctatatattatatatttactatgtgattctttata
atattatacatttgcactgtctcttctacatctgaatcatagttcaatttaaatctgacc
agaatgtgaatgtattttaaattgtcaaatgttgccatttaacatgtttttgcttttcag
GCAACATTTGAGAGAGGACTGGAACTACATGCTAAAGTCACAATTTTTGCAGAAGGTTGC
CATGGACATCTAGCCAAGCAACTATATAAGAAGTTTGATTTGAGAGCAAATTGTGAACCT
CAAACCTACGGGATTGGACTGAAGGAG
gtatcctggtttgtttctgtaattttaattttgaaagatggaatttaaatttatttgtat
tatcaggtagtttataatactgatttaattttagttatattttttcattgtcttgaaatg
ttcattatgactaaaacttatttgcgatatttttcaaggggctagaagatattactgatc
EXON 8  141 bp
gccaccgtgcccagccttctttgatatttgaagtaattttgttgtattcttatatcacag
tttttcacttgtaattttcataaataagacattaaacctggcaagttttatgcattgtgg
tgacataaaaacatttttaaaatactgcaggacttttttgtttgctttttttttttttag
TTATGGGTTATTGATGAAAAGAACTGGAAACCTGGGAGAGTAGATCACACTGTTGGTTGG
CCCTTGGACAGACATACCTATGGAGGATCTTTCCTCTATCATTTGAATGAAGGTGAACCC
CTAGTAGCTCTTGGTCTTGTG
gtaagttatattcccattagggaaaattctgctgctagagttatattaccatcagtgtta
taaaataagggttttgaatctgaagactgtaaaatgctttttatttaaagctttctaatt
ttatcaatatgtaaagtgcttatggctgctgtgtcattaagtctactaaacacacgtagc
EXON 9  144 bp
ttttccaaacagattttatacaatttttaatttacatttggattactgcacatagtgctc
caaatacttttgagtaaaagaaatttaacctacatgttttctgataaacattgcttacat
tttagcttgatttaatttgaaataaaaatgtctaattaaatataagtgtaaatttttaag
GTTGGTCTAGACTATCAGAATCCATACCTGAGTCCATTTAGAGAGTTCCAAAGGTGGAAA
CACCATCCTAGCATTCGGCCAACCTTGGAAGGTGGAAAAAGGATTGCATACGGAGCCAGA
GCTCTCAATGAAGGTGGCTTTCAG
gtaactcttccaacttttattttccttgtttctgtattataaattcagaattgaacatat
aatgtaacaaatttagataaagaataaaaacaatattggaataggaaaagtatgtagagt
ttataaaactgtgtcacacaatacttcaattacaccatgaatttagttttaagaatatat
EXON 10  169 bp
tagggcaggaagaagaaaactgcccttgctctgttttattcctttgctcaattcattttc
atgtatttatttttcagcctttccctacagctctagaatactttaagactgatttggagt
attctgttgttcttgtttaatatgaactaacaaatgtattctgaatctttgtttcctcag
TCTATACCAAAACTCACCTTTCCTGGTGGTTTACTAATTGGTTGTAGTCCTGGTTTTATG
AATGTTCCCAAGATCAAAGGTACTCACACAGCAATGAAAAGTGGAATTTTAGCAGCAGAA
TCTATTTTTAATCAACTAACTAGTGAAAATCTCCAATCAAAGACAATAG
gtaagaaattcctgtgtaaagtatacaaaagaaaattgctgggttatgtgtatttcaatt
gacattaaaagatttgtattgcatctgtcactttatagaaagtattaataagcatgctat
gcaaagaaaactacatggcttattctcaataattacagtcagtgattttttactgtaatg
EXON 11  183 bp
aggtggaggttgcagtgagccatgatcacaccactgtactccaacctgggtgacagagca
agaccttgtctcgaaaaaagaaaaacttcactcatcagctatcaaagtagcaaaatactt
agcgtattttacacacatttgggcagtttcgcacttaacatttcatgtttttaataaaag
GACTCCATGTAACTGAATATGAGGACAATTTGAAGAACTCATGGGTATGGAAAGAGCTAT
ATTCTGTTAGAAATATAAGACCGTCCTGCCACGGAGTACTGGGTGTATATGGAGGGATGA
TTTACACTGGAATCTTTTACTGGATATTGAGAGGAATGGAGCCGTGGACTCTGAAACATA
AAG
gtaattcaaacaagagtatgagtgacatgatcattaaaaattcatgaatgggatctgtta
attagagaaagtgattgttttaatgttttcaacttggagaaattataaatttagtgtcta
agaacagtatattattacttgagggctagtcatatttctttggtgtgataatattttgaa
EXON 12  222 bp
ttttaatgttttcaacttggagaaattataaatttagtgtctaagaacagtatattatta
cttgagggctagtcatatttctttggtgtgataatattttgaagtttttatacaaatagg
cttaagaaaaagtacttcaaaatcatattttgttaagcatttccctcaaaattgttgaag
GTTCTGACTTTGAACGGCTCAAGCCAGCCAAGGATTGCACACCTATTGAGTATCCAAAAC
CCGATGGACAGATCAGTTTTGACCTCTTGTCATCTGTGGCTCTGAGTGGTACTAATCATG
AACATGACCAGCCGGCACACTTAACCTTAAGGGATGACAGTATACCTGTAAATAGAAATC
TGTCGATATATGATGGGCCCGAGCAGCGATTCTGTCCTGCAG
gtaataatttccatctattcctaaatatttgctttaaacattttaggaatgtgattttgt
tcttttaaaaaatgatttctgtatctccttccattccttagaaattgtaaatgacttcat
ccagcttcctttaggaaacatacttttaactactggttttgttaagcctagttcagataa
EXON 13  303 bp
gtacatgtaatttacactcacatcaatagcaatgcaccaaggtcttcataatctctatgg
gtaagcattcagaaagcaacctttaaggtttctgtggctactctttccttaatttttact
tttgaatttaaaaattttttaaagttaggcacttcaatattatttatttttacttttcag
GAGTTTATGAATTTGTACCTGTGGAACAAGGTGATGGATTTCGGTTACAGATAAATGCTC
AGAACTGTGTACATTGTAAAACATGTGATATTAAAGATCCAAGTCAGAATATTAACTGGG
TGGTACCTGAAGGTGGAGGAGGACCTGCTTACAATGGAATGTAAACTGCAGCTAGCCAGT
TTCTTTCAAGTATGGCAAGCTAACGTTAAAATGTTTAGAGATTAACAGATTTCAGAATGT
CTTTCTGCATATTACTGAACAGAATAGTCACAAAATGATTATCAAATAAAAATTTTATAC
TAT
atgtaagattgtcccataaagaaattacgggtattgcttttaaataacctttataagaat
gcagcatcttcctacctcttcagttcttcagagattcagtaccaagagcaaaattcacta
ctggactttacatttgacttgccaaagttaagtaatcaaatataaaaatgaatatatatt