Gene DKK2 Variant 1
DNA : 114.49 KbNT_016354
mRNA : 3636 bp NM_014421
CDS : 780 bp NP_055236
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  928 bp
gccgcagaagcagaagcagcacgcagagaggaggggggcggaagcggtggggagtgagag
aaaaattttcactctttgtcactcttgaattgggggcggaggtaaaaaaaaaaaaaaagt
cctcactgtgggaagctataaaaagcaaagaggactggggagagagcagagagagagaaa
GCGGGAGCCCGCGGCGAGCGTAGCGCAAGTCCGCTCCCTAGGCATCGCTGCGCTGGCAGC
GATTCGCTGTCTCTTGTGAGTCAGGGGACAACGCTTCGGGGCAACTGTGAGTGCGCGTGT
GGGGGACCTCGATTCTCTTCAGATCTCGAGGATTCGGTCCGGGGACGTCTCCTGATCCCC
TACTAAAGCGCCTGCTAACTTTGAAAAGGAGCACTGTGTCCTGCAAAGTTTGACACATAA
AGGATAGGAAAAGAGAGGAGAGAAAAGCAACTGAGTTGAAGGAGAAGGAGCTGATGCGGG
CCTCCTGATCAATTAAGAGGAGAGTTAAACCGCCGAGATCCCGGCGGGACCAAGGAGGTG
CGGGGCAAGAAGGAACGGAAGCGGTGCGATCCACAGGGCTGGGTTTTCTTGCACCTTGGG
TCACGCCTCCTTGGCGAGAAAGCGCCTCGCATTTGATTGCTTCCAGTTATTGCAGAACTT
CCTGTCCTGGTGGAGAAGCGGGTCTCGCTTGGGTTCCGCTAATTTCTGTCCTGAGGCGTG
AGACTGAGTTCATAGGGTCCTGGGTCCCCGAACCAGGAAGGGTTGAGGGAACACAATCTG
CAAGCCCCCGCGACCCAAGTGAGGGGCCCCGTGTTGGGGTCCTCCCTCCCTTTGCATTCC
CACCCCTCCGGGCTTTGCGTCTTCCTGGGGACCCCCTCGCCGGGAGATGGCCGCGTTGAT
GCGGAGCAAGGATTCGTCCTGCTGCCTGCTCCTACTGGCCGCGGTGCTGATGGTGGAGAG
CTCACAGATCGGCAGTTCGCGGGCCAAACTCAACTCCATCAAGTCCTCTCTGGGCGGGGA
GACGCCTGGTCAGGCCGCCAATCGATCTGCGGGCATGTACCAAGGACTGGCATTCGGCGG
CAGTAAGAAGGGCAAAAACCTGGGGCAG
gtaggaaaacccccaaacacattcttcagacagaagaggcaggggccagctctcttgggc
tagcggtttgccattgcatcttgcaacattcggagcgtggccccagatacagagaacagg
cggctggggagggattcaccgaacagggtctgcgtgggcggggggtgtctgggtggctgc
EXON 2  151 bp
aaggtcctcaattaagtgtgactacttaggctctaggttcagaacattatgatgatggta
tagttccttccgggtgagatatattgtgattcattttctatcatgatttgctatagtaat
gtttcataagtgaaacacgatctaatcctttacttctggtgttgttccacttgatgacag
GCCTACCCTTGTAGCAGTGATAAGGAGTGTGAAGTTGGGAGGTATTGCCACAGTCCCCAC
CAAGGATCATCGGCCTGCATGGTGTGTCGGAGAAAAAAGAAGCGCTGCCACCGAGATGGC
ATGTGCTGCCCCAGTACCCGCTGCAATAATG
gtaaaagatctcactaagtgttaatgggcctctttcttttcatcatcataagcctgtctc
tcaagtcaggctatcgtctccttactcagactcctgaaatataagaagcctggtagaact
ggtttaggtagtgtaagattacctggattacctccccaaatcttagttttcctagagtct
EXON 3  156 bp
ttcactttagggccaaagtatgctcagtctcaataaataagtaaatgaatggatgggtgg
atagatagatagatacacagatagataaatggcttcatatttcacatcaagagagtatgt
ggataagtatcacatttcatagaattgaattagtctaactgattatatgatcatctccag
GCATCTGTATCCCAGTTACTGAAAGCATCTTAACCCCTCACATCCCGGCTCTGGATGGTA
CTCGGCACAGAGATCGAAACCACGGTCATTACTCAAACCATGACTTGGGATGGCAGAATC
TAGGAAGACCACACACTAAGATGTCACATATAAAAG
gtagggatatctgtagttctggggtttttttaaaataaagaaatagaagaaaaatataga
taattaattccattggttttagaaaaaattacaaggaagtttctttaatcctagctagtc
attaaacttgttatttaggtggcaaataatggaaacagaccataatagatttatgtgata
EXON 4  2401 bp
cataatagatttatgtgataagaggcagagccaattggtatcaaccaagacttttcatta
taaatggtaacaacatagaagatagtataagtaaaaatattttatgtgcttctgattgca
aaatagaattttttttttctgaagtgtcagggtaacatctattggtcatcatctctgcag
GGCATGAAGGAGACCCCTGCCTACGATCATCAGACTGCATTGAAGGGTTTTGCTGTGCTC
GTCATTTCTGGACCAAAATCTGCAAACCAGTGCTCCATCAGGGGGAAGTCTGTACCAAAC
AACGCAAGAAGGGTTCTCATGGGCTGGAAATTTTCCAGCGTTGCGACTGTGCGAAGGGCC
TGTCTTGCAAAGTATGGAAAGATGCCACCTACTCCTCCAAAGCCAGACTCCATGTGTGTC
AGAAAATTTGATCACCATTGAGGAACATCATCAATTGCAGACTGTGAAGTTGTGTATTTA
ATGCATTATAGCATGGTGGAAAATAAGGTTCAGATGCAGAAGAATGGCTAAAATAAGAAA
CGTGATAAGAATATAGATGATCACAAAAAGGGAGAAAGAAAACATGAACTGAATAGATTA
GAATGGGTGACAAATGCAGTGCAGCCAGTGTTTCCATTATGCAACTTGTCTATGTAAATA
ATGTACACATTTGTGGAAAATGCTATTATTAAGAGAACAAGCACACAGTGGAAATTACTG
ATGAGTAGCATGTGACTTTCCAAGAGTTTAGGTTGTGCTGGAGGAGAGGTTTCCTTCAGA
TTGCTGATTGCTTATACAAATAACCTACATGCCAGATTTCTATTCAACGTTAGAGTTTAA
CAAAATACTCCTAGAATAACTTGTTATACAATAGGTTCTAAAAATAAAATTGCTAAACAA
GAAATGAAAACATGGAGCATTGTTAATTTACAACAGAAAATTACCTTTTGATTTGTAACA
CTACTTCTGCTGTTCAATCAAGAGTCTTGGTAGATAAGAAAAAAATCAGTCAATATTTCC
AAATAATTGCAAAATAATGGCCAGTTGTTTAGGAAGGCCTTTAGGAAGACAAATAAATAA
CAAACAAACAGCCACAAATACTTTTTTTTCAAAATTTTAGTTTTACCTGTAATTAATAAG
AACTGATACAAGACAAAAACAGTTCCTTCAGATTCTACGGAATGACAGTATATCTCTCTT
TATCCTATGTGATTCCTGCTCTGAATGCATTATATTTTCCAAACTATACCCATAAATTGT
GACTAGTAAAATACTTACACAGAGCAGAATTTTCACAGATGGCAAAAAAATTTAAAGATG
TCCAATATATGTGGGAAAAGAGCTAACAGAGAGATCATTATTTCTTAAAGATTGGCCATA
ACCTGTATTTTGATAGAATTAGATTGGTAAATACATGTATTCATACATACTCTGTGGTAA
TAGAGACTTGAGCTGGATCTGTACTGCACTGGAGTAAGCAAGAAAATTGGGAAAACTTTT
TCGTTTGTTCAGGTTTTGGCAACACATAGATCATATGTCTGAGGCACAAGTTGGCTGTTC
ATCTTTGAAACCAGGGGATGCACAGTCTAAATGAATATCTGCATGGGATTTGCTATCATA
ATATTTACTATGCAGATGAATTCAGTGTGAGGTCCTGTGTCCGTACTATCCTCAAATTAT
TTATTTTATAGTGCTGAGATCCTCAAATAATCTCAATTTCAGGAGGTTTCACAAAATGGA
CTCCTGAAGTAGACAGAGTAGTGAGGTTTCATTGCCCTCTATAAGCTTCTGACTAGCCAA
TGGCATCATCCAATTTTCTTCCCAAACCTCTGCAGCATCTGCTTTATTGCCAAAGGGCTA
GTTTCGGTTTTCTGCAGCCATTGCGGTTAAAAAATATAAGTAGGATAACTTGTAAAACCT
GCATATTGCTAATCTATAGACACCACAGTTTCTAAATTCTTTGAAACCACTTTACTACTT
TTTTTAAACTTAACTCAGTTCTAAATACTTTGTCTGGAGCACAAAACAATAAAAGGTTAT
CTTATAGTCGTGACTTTAAACTTTTGTAGACCACAATTCACTTTTTAGTTTTCTTTTACT
TAAATCCCATCTGCAGTCTCAAATTTAAGTTCTCCCAGTAGAGATTGAGTTTGAGCCTGT
ATATCTATTAAAAATTTCAACTTCCCACATATATTTACTAAGATGATTAAGACTTACATT
TTCTGCACAGGTCTGCAAAAACAAAAATTATAAACTAGTCCATCCAAGAACCAAAGTTTG
TATAAACAGGTTGCTATAAGCTTGGTGAAATGAAAATGGAACATTTCAATCAAACATTTC
CTATATAACAATTATTATATTTACAATTTGGTTTCTGCAATATTTTTCTTATGTCCACCC
TTTTAAAAATTATTATTTGAAGTAATTTATTTACAGGAAATGTTAATGAGATGTATTTTC
TTATAGAGATATTTCTTACAGAAAGCTTTGTAGCAGAATATATTTGCAGCTATTGACTTT
GTAATTTAGGAAAAATGTATAATAAGATAAAATCTATTAAATTTTTCTCCTCTAAAAACT
G
aattcaaagctccttgtcttttgtctacgggaagaattttcatagaatcatactttctga
gagttcaactggacttggtctgattttgaggactgggtgtgaatcatttggaggacatca
gcatgagataactcagagcagtttactattacaaaaggtagtttatttcttggcagttta