Gene DHX15 Variant 1
DNA : 57.08 KbNT_006316
mRNA : 3003 bp NM_001358
CDS : 2442 bp NP_001349
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  232 bp
cagccgctccgaggaggggaaagctacaggaagagggaggagacccaagaaaggtcggac
caatgaggcagcgggcgggacaggagttcccgcctttgggcgtcgtgcgcgcgcacctcg
ctcacacgcacactcgcacgcacgcacgctgcggaagcgcgcgcgcgcgcaggcccagcc
CTCGTCGCCGCCGCCATTTTAGCTGTTGGTTCCGGCCGCACCGTGTGGGCTGTAGTAGCG
GGAGGGGTGGGGGTCCTCCAGAGTTAAGTGGCTGTCCTCGACTGTGCCCATACAGCAGCC
AGCTTTCTTCCTTAATAACTGCCCGTTCGAAGAGTGCGAGGATGTCCAAGCGGCACCGGT
TGGACCTAGGGGAGGATTACCCCTCTGGCAAGAAGCGTGCGGGGACCGATGG
gtaagccaggccgggggcgcgaggcggcagctcgggctttgttggggtcctggcagggag
cgggccggggctggcctggccgagcgggtcctggagcccgagcctttgtttctctctggg
ctgggttcactagcggcgggtaggagaagcgcggcgcccgttcggcccggcaagggcgcg
EXON 2  440 bp
tgtggtggagaatgggaaacccttgattgtagggtattttttattatttctgatagttac
ataatccattggactttttattcatttgaacgttggacatttactctctttgtgattata
acgctaccgtgaacattctgcataaaattcagaatctgaattctaaatttttgtttttag
GAAGGATCGAGATCGAGACCGGGATCGTGAAGATCGGTCTAAAGATCGAGACCGAGAACG
TGATAGAGGAGATAGAGAGCGAGAGAGGGAGAAAGAAAAGGAGAAGGAGTTGCGAGCTTC
AACAAATGCTATGCTTATCAGTGCTGGATTACCACCTTTGAAAGCTTCCCATTCAGCTCA
CTCAACCCACTCAGCACATTCAACGCATTCAACACATTCTGCTCATTCAACGCATGCCGG
ACATGCAGGTCACACGTCACTTCCACAGTGCATTAATCCGTTCACCAACTTACCCCATAC
TCCTCGATACTATGATATTCTAAAGAAACGTCTTCAGCTCCCTGTTTGGGAATACAAGGA
TAGGTTTACAGATATTCTGGTTAGACATCAGTCCTTTGTACTGGTTGGTGAGACTGGGTC
TGGTAAAACAACACAGGTGA
gttattgtataccatggtacatatttcatttatgtttaagtttaccaaatgttgcatatt
tgattctggtggtcatttcccttgtctgtcctatagaacatcttgaagaatagctgattt
gatgtttaattggcactctgaatttcagagtggaaatcctatagagaatacctctcccct
EXON 3  193 bp
cacataactgttccttggtttagagagcttgtgttgttacaagttttgaatcacaagtct
tatagtcatttgcctaattggatttggttttaaatcattagaatgagataaagtgcttta
tgttacatatacttgatatgcaggcagaatagaattaatttaaatgtgaaattatttgat
AGATTCCACAGTGGTGTGTGGAGTACATGCGATCATTACCAGGACCCAAGAGAGGAGTTG
CCTGTACCCAACCCAGGAGAGTGGCTGCAATGAGTGTGGCTCAGAGAGTTGCTGATGAGA
TGGATGTGATGTTGGGCCAGGAAGTTGGTTACTCCATTCGATTTGAAGACTGCAGTAGTG
CAAAAACCATTCT
taagtaagtactatatctttaatgacgcttttagtcctctgcttgccattttctgctatt
agatagaagactttgctagtgcaggcttatgtcatccaaatttagaattatccaaagtag
gccttcttagacttaccacatgaccttagtttaattatatattattggtaatctatagtt
EXON 4  165 bp
tgtatactcttaaaagattttcttgaaacttaattttgcaattgatcatgaaacagtagc
acatttgtttggggcagaagtttatttttaatttaccttatgtctttgcatttcattttt
gtcacgaagtttggttttaaaatgacctaacggaacctttaaccaacatgttctttggaa
TATAGGTATATGACTGATGGGATGTTACTTCGTGAAGCTATGAATGATCCCCTCCTGGAG
CGTTATGGTGTAATAATTCTTGATGAGGCTCATGAGAGGACACTGGCTACAGATATTCTA
ATGGGTGTTCTGAAGGAAGTTGTAAGACAGAGATCAGATTTAAAG
gtgaagtaatttcttctctccatttaactatatatgtgtgtatgtgggcataaaaatggg
gaatacatactgatcaataaccaactgtaagaaatcacctgtaaaagaaggaactagtaa
gtaccttcttgttttgtttctgctttgctgtgctttcattttagactttatttctccccc
EXON 5  219 bp
tgtaaataacttttactatagttcagccattatgtatttgatttttcatttacagtttat
ttgaaggttttcatgggcatttttatagctgatatatgtagaatagtaaatattgctata
ctgtaagaccatgtaagaatccttgaagacagcttcaaataatttactgttttctttcag
GTTATAGTTATGAGCGCTACTCTAGATGCAGGAAAATTCCAGATTTACTTTGATAACTGT
CCTCTCCTAACTATTCCTGGGCGTACACATCCTGTTGAGATCTTCTATACTCCAGAACCA
GAGAGAGATTATCTTGAAGCAGCAATTCGAACAGTTATCCAGATTCATATGTGTGAAGAG
GAAGAGGGAGATCTTCTTCTTTTCTTAACTGGTCAAGAG
gtattgttttaattttcttcattatttagcttttgacatactgtttctaatatgcagcaa
ccttaatcataagaacatgttaatcatattttttatttcaatgttcttcaacctgattgt
attaatatgtaaaatatataaccccttttatctgcatactgtaggaatacttctgtatac
EXON 6  168 bp
ggattgttttggaaatcccattgaaatttgctaaattagttttggttactaaattgaaaa
cagggtatccatgaagtgaaagaagatggcatacataaaacagactgcatagaactagga
ttataataaatactttaaaatgtttcagtattcgtttttagactcacttttattttgtag
GAAATTGATGAAGCCTGTAAGAGAATAAAGCGTGAAGTTGATGATTTGGGCCCTGAAGTT
GGTGACATTAAAATCATTCCATTGTATTCTACACTTCCACCTCAGCAGCAGCAACGCATT
TTTGAGCCTCCACCTCCCAAAAAACAGAATGGAGCAATTGGAAGAAAG
gtaacattagaaatgctctttataaatatttcactaataatgatttatgagatataaact
gtattcagttataaaggactaagttatgggtgattgtgatctaggttttatacaacaaaa
taatatccatttgtagggttccgcatatctcttgaccctaaagtaagaatgagtactgct
EXON 7  87 bp
tggttccttaaatattaatttacctttttaaagcattggccattgaagatcaaatgatat
ttctagtttatttgctggcttgaaattccttgtgtcagtgaaagttagtggctgatcttt
aacagtcctgttaattttatttgatatgtaatataatttatatactctatttcttaacag
GTAGTTGTGTCAACTAACATAGCAGAGACGTCTTTGACAATAGATGGTGTGGTGTTTGTG
ATTGATCCTGGATTTGCGAAACAGAAG
gtacatatttagtggatactttataaattagagttggtttaacagtacttacaaccaatt
catttaatggctaaaatttacctttcagaattattttcctatctttttttttatttgcaa
atttctgctgtatgaaccctttatgttttggctggctctcagaaattaagacagtattta
EXON 8  150 bp
gaatgtctgaaagaactttaaggttcaggatggtgggttgtctattgtagcagcatgatt
tatggctatcgatatttctttatttattttggaattaactgtgggctttggatacttctg
ttgcatcacaattttgtgtttgactgaagaaagactcttgtgttatttcaattccaatag
GTCTACAATCCTCGAATCAGAGTTGAGTCCCTTTTGGTGACAGCTATTAGTAAAGCTTCA
GCTCAGCAAAGGGCTGGTCGAGCTGGACGTACCAGACCTGGAAAATGCTTCAGACTTTAC
ACAGAGAAAGCTTATAAAACAGAAATGCAG
gtatggggtattgtcgtttcctgccgatatgtttaaaatgttaggttgaattatcttacc
agaagaacattgccttatttacttaatcttgccttttaggattaaaagctccttagcttt
tccaggagtgaaatgtatggtgtaattaacttagatagtcgtacacccccttattccagg
EXON 9  109 bp
aaagatagttggagaaaaatggtttctctctagtctagcctacaagtatttatctctact
gagacagtgtagaagtaatgccaaaacaaatagctcaggaggcagcagatttttgttttc
tggaacgaggagactgaggcatttttaacataaccaataaatgtttttgttctttgctag
GATAACACCTATCCTGAGATTTTGCGTTCTAATTTAGGATCAGTTGTGTTACAATTGAAG
AAACTTGGTATTGATGACTTGGTACATTTTGATTTTATGGATCCACCAG
gtatgacttatcaaaacacatttttatcagatcttttaaccaaaattgactcttagtgtt
tttctccatcctatttaatatatgtattaaatacattttgctttttccatccagtatgca
tcaagattaagtcttacatgatagcattaaaactaaaaaaggtgacagttatatgagcac
EXON 10  192 bp
ttttgcaatgtttttatgattcattgtttgctagatctgtataattgaattggatgacag
tttgagtttgagtttggtccactgcaaaatgaaaaatgagattgcttataatagtttgta
ctttgtcacatttttgcttgcttaaggcaccgtgtctaatagattgtcttttaccactag
CTCCTGAAACTCTGATGAGAGCCCTGGAACTTTTGAATTACCTGGCTGCTTTAAATGATG
ATGGAGATCTGACTGAATTGGGATCCATGATGGCAGAGTTTCCTCTAGATCCACAGCTCG
CAAAAATGGTTATTGCAAGTTGTGACTACAACTGTTCTAATGAGGTCCTATCTATTACTG
CTATGTTGTCAG
gtaatagagggaaaggaacaaaaaaaagcccagctcttcaaagtttgggtggacttcact
tttgtttttgttttttaatttttagtatgatagtggattttatagatggttttaaggaat
taattttgttttctaaataccttgtaaatagcttcgtaatgacatagtgcttacaaaagt
EXON 11  123 bp
gatgtggttaggtgttgatgtaccaaatcaaggtagtaaacaatccaagatgcagttgga
ggccatcctgccctgccctatgctctgtgaactgacctagctaggccttgttcctctatc
tgtgaatgcgtgactcatcgatatgggcgtttgtgttgggcccataccaaccttgtttag
TCCCACAGTGTTTTGTTCGCCCCACGGAGGCCAAGAAAGCCGCAGATGAGGCCAAGATGA
GATTTGCCCACATAGATGGAGATCATCTGACACTGCTGAACGTCTACCATGCTTTTAAAC
AAA
gtaagtgtaaatttgattggagacactcttgtctaaatgtcacttgcagtgtataagatg
tttctttgtcccactttgatttattatccgtgacaacttatattagaaacccagaggtac
ttttgaaaaactcctgacgagcatttaaaatagaaattgccaatctttttcaaagttgtt
EXON 12  191 bp
tcacactacagatctttgagaaagttggtaacattgcagttcatttaaagaaaatgttgt
gggtaaatctcctttctggtttatttagcttattctttataacaatttttttaattagag
aacattcctgtgtgggtgattcatggtgccttcttttctccccgccttctacctttttag
ATCATGAATCGGTTCAGTGGTGTTATGACAACTTCATTAACTACAGGTCCCTGATGTCCG
CAGACAATGTACGCCAGCAGCTATCTCGAATTATGGACAGATTTAATTTGCCTCGTCGAA
GTACTGACTTTACAAGCAGGGACTATTATATTAATATAAGAAAAGCTTTGGTTACTGGGT
ATTTTATGCAG
gtatgtagataatatgggaatgaataactaagtattcatatgacactgatttctattaac
agtcctttgaatccactcaaaagcaaaagtgagtttgtgcatgctcataaaaatttatct
taaatgttggtacatccagtttctttgagtgaattaatatactaagaaattttaagtatt
EXON 13  170 bp
gttggatttggcccacaggcagcagtttgcttatctctgcttttatcagacagtgataaa
taagtatagccatagaatgaaaagtaaaagggaggcctgcctcttcctaattatgtaggt
agctttacaactagcaagtcagaagcattgtattaataatatactgggttttggtttcag
GTGGCACATTTAGAACGAACAGGGCATTACTTAACTGTGAAAGATAACCAGGTGGTTCAG
TTGCATCCCTCTACTGTTCTTGACCACAAACCTGAATGGGTGCTTTATAATGAGTTTGTT
CTAACAACAAAGAATTACATCCGGACATGTACAGATATCAAGCCAGAATG
gtaagtacaccttttgttctaacagttttttgttagtactttgctcaaaatggaacctga
ctgttgctagagtcatggccttgcattcactcattgagaatttatatttcagtgtgtagg
tatgagggaattgactggatggtgtgattaatctttcacacccttcctttgttaagtgga
EXON 14  564 bp
acttaacacatttctaaaagtgctatttgtaaggattagttatttgtatttttctgagac
ttgaattcatagatttgccttggttcatcagtatattaatgaataatgcctatcctatta
acaactccagtacttcaattaaatgttaatttggaaatttttctgcccacttctaaacag
GTTGGTGAAAATTGCCCCTCAATATTATGACATGAGCAATTTCCCACAGTGTGAAGCAAA
GAGACAGTTGGACCGCATCATTGCCAAACTTCAATCCAAGGAATATTCACAGTACTGAAT
TCAGTGCTTAGAACTGAAGTTATTGAGAGGACAGCTTTAAAAGATGAATGAACTCAAAAG
TTCGAGTTGTGCTCTTCACGTTGGTTCGATAATGGCCTTTATTTGAAAGCTTTTTAATTT
TTCTTTACAGTAAATATTCCATTCTGATTTCATAAATTAAACATTTATGCCTCCCTTTTG
TGTTGACACTGTAGCTCATACTGGAAAAGTCGATCAATGTTTTGCAGTTTATTGAAAGTA
GTTCTATATATAACAATGTTATAAGCATTTCTTTAGAAATGGTTGAAAATGCTTCTAAAA
TGTGATTATCGACCATGGTATGCATGATCGTTGTAATTGTTGACATTCCTTTTAGAAGTT
GTGAAATGTTACAACTTGTGCTTATGTAGACACAATCTTCTGTCTCAGTACAGAGGCACT
GACTTCAATAAAGTCTATTTATAC
taattttggccaaagccctttggtatctttgttctagtctctaagtatagttgtttttca
agtgtggagcttttttattattataattatactgttactacatatttagtatctttctac
caggagtactccttaggaaaagtagctgttaaagcagtatttttaagagcatggcttagc