Gene CDS1 Variant 1
DNA : 66.28 KbNT_016354
mRNA : 2384 bp NM_001263
CDS : 1386 bp NP_001254
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  615 bp
ccgcctcccagctcctcagcctcctcccgccccaccgctcccaccttttctcaggccccc
acctgccagcacgcagaggcgggggcggggtcgcgggccgggctcctgacgtcacctcac
ggggaggcggggctgtgggaaccgcagtgcagcgcagaggggcggggcctgcggcgcgag
ACCTGGTGCGGGAGGCCCGGGCAGGGAGAAGTGTGCGGGGCCGGGACAAGCCGGCTCCGA
GTCCGGCTCCGGGGGGCGGGGCGGGAGGGGCCTGCGCGGCGGCGGGAGCCCAGAGCCGCG
CTAAAGCGGGTCAAGCGTCCTCCTTTTCTCCCCGCCCCTTCTCCTCCTCCTACCTGGGCC
TCTGCGTGGAGACGCGCACCTGGCAACCGGAGGCCGCGTCTCCGCCTTCTCTGCTCGCGC
CTGGCGCCCGGAGCCTGCCCGGGACCTCCGCCGGAGCCGCGCTCGCTGCAGGCGGCCTCG
AGCGCTCTCTCGTTGATGCCGTTTTGGAGGTGACCGGCGCGGCGGCCGCTCTATGGTGGG
GCCGCGTTAGTGGCTGCGGCTCCGCGGGACTCCAGGGCGCGGCTGCGAGGTGGCGGGGCG
CCCCGCCTGCAGAACCCTGCTTGCAGCTCAGGTTTCGGGGTGCTTGAGGAGGCCGCCACG
GCAGCGCGGGAGCGGAAGATGTTGGAGCTGAGGCACCGGGGAAGCTGCCCCGGCCCCAGG
GAAGCGGTGTCGCCGCCACACCGCGAGGGAGAGGCGGCCGGCGGCGACCACGAAACCGAG
AGCACCAGCGACAAA
gtaagtggagccgagagaggcggacgccgcgccctggctgggtcctggttggaagcggga
cacttgagagcaagggtggggcccgtccagcgtcaggtgaggctgcacgctgccggtgca
ccttcctccctgcctggcactgcttcctccttctccagagggggtcgggacccgggatcc
EXON 2  128 bp
atagtcaaactttcctaacaaagaagtatagcagtgctaagattttcaagataaatagta
gtttctttgtttcagattatgtcactgagatttgacacactgagcaataaatgaatgtat
tggccagcctgtgcttttttaaacgtgattttgcaaagtaatttgtctttttaattttag
GAAACAGATATTGATGACAGATATGGAGATTTGGATTCCAGAACAGATTCTGATATTCCG
GAAATTCCACCATCCTCAGATAGAACCCCTGAGATTCTCAAAAAAGCTCTATCTGGTTTA
TCTTCAAG
gtatgattggatgaagatgagtatatcttagtgcacaagataggctttgaggttatcctt
gtccatgtaataaatttggctttttgtaagttttccagccatggtattaggtggtcaaaa
aggccacctaatatccgaggtatagttctatgtatttaatgtgtatccacccttaaaacc
EXON 3  97 bp
aatttatctcccagtgtgtgaatgaatgctgtttgttttttgtttttgttgtttgttata
taaagtgaagtagtagaatcttatagttaaggaaaattcataaatctggcaaatcaatac
tgaaaccacacaaaaaaccttaagaacacgttaaatactaactttacattttctttgtag
GTGGAAAAACTGGTGGATACGTGGAATTCTCACTCTAACTATGATCTCGTTGTTTTTCCT
GATCATCTATATGGGATCCTTCATGCTGATGCTTCTT
gtaagtttttgacttttccctgagtgtctcttgctttgtttttcaacatttatataggat
tgaagtaatttgagcatatcataaaaaagaagctaattcaacactcagtcacagaatatt
tagttcctttaagtgtcttttatttcatgatatgatctaacttaatcttttctgtttgca
EXON 4  98 bp
cctttgagttatcacttgattttagagacatggaatattgcattttttactgacatttag
cataattaaacattggtagattaagattttttaaatacatatgacaaactgctttattga
atgattaagcacaaatgtaaacattgagaaatgtatgttaatgttttctcttggtttcag
GTTCTGGGCATCCAAGTGAAATGCTTCCATGAAATTATCACTATAGGTTATAGAGTCTAT
CATTCTTATGATCTACCATGGTTTAGAACACTAAGTTG
gtaagtaagcttgaaactatttcagatatgaaaagttaatttctgaagtttgtaaaggaa
gcgtcttgatcagtcagtatccactcaatttaccctatagattgattctagagaaagata
aataaaaataatgtaattgaattttgaaaagatcacctttgtctttcctactccaataca
EXON 5  140 bp
tcaataaatttgaaattaagtttaaaacaggaaaatagcattttggtaaaatatatcttg
aattggtcttctgaactttgttttgatctttgtgtcatcagaatgtagaaaataattttg
ttgagtttgaggggaaggaaagcttcaaatatagaaaagctaattgtttttaaattatag
GTACTTTCTATTGTGTGTAAACTACTTTTTCTATGGAGAGACTGTAGCTGATTATTTTGC
TACATTTGTTCAAAGAGAAGAACAACTTCAGTTCCTCATTCGCTACCATAGATTTATATC
ATTTGCCCTCTATCTGGCAG
gtaagttaaggaatattctgtattgatatatagttaacatattttccatgtttattttta
tttctgttattttaattagtaattttttggttaaattttattccagcctctctttttcat
tgtttcttgtgtataaagctatttctttcatcatgttcttaaatagcaattactccctta
EXON 6  59 bp
tgtttccctcaagaaacttactttaaatgcttaatgtaagatagtaggagagatggcatc
tgagtaagtagctaaaatatgcctagctgtgatacagcaaattggtttatttgggctcaa
ggaatcttaaccctttgtaccaaattgtacaacgagcacatgttttttgttcttgaacag
GTTTCTGCATGTTTGTACTGAGTTTGGTGAAGAAACATTATCGTCTGCAGTTTTATATG
gtgtgtattaactattattccttagtcattatctgtgataaaaacccttaactttttttt
ttctgtagtgagaagatacagtcgaatctgctagctgttgttttgcatgaatgtgaggga
tacttggatttcagatgaccattagatataaactattaaagttgagaagtttgtgaggat
EXON 7  83 bp
ggttccagtaggcaacaaaacaaacataatttactaacagtgtttttattttatatgact
ctaacttgtacattttgaccaaaagtcatggtagaaatttgggtttcaaatcgctgttgc
ttcttcagctgcactgatcagttgtgttcactaatttttgtattgttgggctattaacag
TTCGCATGGACTCATGTCACTTTACTGATAACTGTCACTCAGTCACACCTTGTCATCCAA
AATCTGTTTGAAGGCATGATATG
gtaaggcaacagaattatgctgctttataagtatgtcatagcacttttatagttctttaa
cgttggatagtgtcttacagatttctactaaaatgtactgtttgttgttcttatattcca
ttaaactatcttactgagttttgcttactctttgacaactaaagacaaaatgcttcatta
EXON 8  88 bp
caaatttggttgatatttatcatttctactgttttggcaagtgttatgttctgggtaggc
tgcagtgcaatccaaagggttattctgatggttcattatgaatcataacctttccgaata
tctgccacttactcaggtgaacttttttctgctgacttttttttttttttttaaaaacag
GTTCCTTGTTCCAATATCAAGTGTTATCTGCAATGACATAACTGCTTACCTTTTTGGATT
TTTTTTTGGGAGAACTCCATTAATTAAG
gtaatggaaaaattttataagcaagccactatgtaaccttaaagattagccactggagaa
catttccaacaactgtgctgttgtgcattttttatttttgaggtgctttgattttcctta
gctgcatggtgcagaagcagcaaaccatatttctcagtacttccatctgggttcttcatc
EXON 9  69 bp
attttcactagtaaatcaagatcagagaaaaggaaaaagggttttgaactattccaataa
gagaaaaagtaaggagagatgtacaagttattgaggaaatagtttatatatatatatata
tatatattgtgagttttgtgagtgcagtaaagctttttaattttatttgcccttttttag
TTGTCTCCTAAAAAGACTTGGGAAGGATTCATTGGTGGTTTCTTTTCCACAGTTGTGTTT
GGATTCATT
gtgagtattactaagatttttattttgtatacatttcgaaatatgataccaagcttactg
gtctaattttaaacctagaaaaattaaaccacaaaatgctaataatatatttattgaaac
ctactgaaaagaaccagttctgtacctcagcagcccttatcctggctacatatagaatca
EXON 10  153 bp
ttactaggataattatgaccatttaactttgaaaatacatagcaaaatattaagacaaag
aaattctggcattctatctctggcctttctgatgtataacttaaaagatatatgtttagt
caatgtgttatgaacttttgctttgttttttgttttgttttgttttgtttttaatatcag
GCTGCCTATGTGTTATCCAAATACCAGTACTTTGTCTGCCCAGTGGAATACCGAAGTGAT
GTAAACTCCTTCGTGACAGAATGTGAGCCCTCAGAACTTTTCCAGCTTCAGACTTACTCA
CTTCCACCCTTTCTAAAGGCAGTCTTGAGACAG
gtacagtaaaagttcaagataaacatggttagagatcttccactctgaagattaagcttc
ctttattatttatttatttatttaattaatttattgttgttttgagacagagtttccctc
tgttgcccaggctggagtgtagtggcgtaatctcaacttactgcaacctttgctcaagtg
EXON 11  120 bp
ggatggtacagaaggcttaaatagacttttcttccttgatccttaaagtttgaaaaatta
acaaaaatgtggtgcgtgctttgacttactatttacacaatggttcttagatcaggtggt
atgctcaaatacaatttcagtgaaattagcccctctcctccccttctttctcctctttag
GAAAGAGTGAGCTTGTACCCTTTCCAGATCCACAGCATTGCACTGTCAACCTTTGCATCT
TTAATTGGCCCATTTGGAGGCTTCTTTGCTAGTGGATTCAAAAGAGCCTTCAAAATCAAG

gtgtgtgtttagattctttgttatattattagagaatataattagagaatgtaacctagt
tggaatttggtccgctcatgatctacattaagcccctaggccacaacttttatatcctat
ttgtttcgaccccacagaaatgctgccacgttgatctgaatgtattctttctttttaggt
EXON 12  104 bp
atttggaagatgtggttttaatctgctggatgtgttctaataagtttttatttagtgaaa
aaaatccaatagtaatgtattttcgttagagtgagtccatgacgccaaagagacacagat
aggaattttatagcaggtgattttttgaaaatttgctaatatatttgtttgtttctaaag
GATTTTGCAAATACCATTCCTGGACATGGTGGGATAATGGACAGATTTGATTGTCAGTAT
TTGATGGCAACTTTTGTACATGTGTACATCACAAGTTTTATAAG
gtacttttacacttgagacattttttagatgatttctttgagttctcatttccatcaaca
ttagtttgagtaagttaactttttccgtcaatggtaatctacaatattaaagtgaatggt
ggcccctggaattagagtcttgagcaagatggttaacttgtaattgttttacctacattt
EXON 13  630 bp
tgctgtaacccttgacactaacattgcacattaaagtgagctattatcaagagctatttt
aattctgtaaagattcctactctacacttaaaggaatggtttgttttaaattggaggtat
gtgcttcacttatccctattaaaataacacgaacttgtcttctttgccttttatcattag
GGGCCCAAATCCCAGCAAAGTGCTACAGCAGTTGTTGGTGCTTCAACCTGAACAGCAGTT
AAATATATATAAAACCCTGAAGACTCATCTCATTGAGAAAGGAATCCTACAACCCACCTT
GAAGGTATAACTGGATCCAGAGAGGGAAGGACTGACAAGAAGGAATTATTCAGAAAAACA
CTGACAGATGTTTTATAAATTGTACAGAAAAATAGTTAAAAATGCAATAGGTTGAAGTTT
TGGAGATATGTTTCTCTCTGAAATTACTGTGAATATTTAACAAACACTTACTTGATCTAT
GTTATGAAATAAGTAGCAAATTGCCAGCAAAATGTCTTGTACCTTTTCTAAAGTGTATTT
TCTGATGTGAACTTCCTTCCCCTTACTTGCTAGGTTTCATAATTTAAAAGACTGGTATTT
AAAAGAGTCAAACACTATAAAATGAGTAAGTTGACGATGTTTTAAGATTGCACCTGGCAG
TGTGCCTTTTTGCACAAATATTTACTTTTGCACTTGGAGCTGCTTTTAATTTTAGCAAAA
TGTTTTATGCAAGGCACAATAGGAAGTCAGTTCTCCTGCACTTCCTCCTCATGTAGTCTG
GAGTACTTTCTAAAGGGCTTAGTTGGATTT
aaaaaaaaaaaaaaaagattgtctacttttcaaagaagtaaccatttgccaggggaaaac
attctgcttttaggtagtttcaaaattcaggggagggagcctgaaatttttgccatgatt
ggtttgttagaaagagcaggcatcagactacttctgataaaattgtttggaaggtcacga