Gene APBB2 Variant 1
DNA : 399.85 KbNT_006238
mRNA : 4168 bp NM_173075
CDS : 993 bp NP_775098
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  54 bp
ccttccctcgcgcagccgctgccaaagcctggagaagtggaatctcgtcagcgccgctcc
ctgcgcgggactcgcggaacggcactgagcatgctcagttgccggagcccgttctggtct
caagtaggaagctagtgcgctgtaaccgcatctgatctgggcgctccgggaagggcgaga
CTGGAGCAGAGCCGCTGGGCGCCGGAGCCGAGGCGAGCGCCGCGCGCACCACTG
gtgagcccagctttcttccttgcctttgccccggattccggggcagcacgagagtgctgg
ggaaacacccgggtagcggcagcagcgtgcggcgagcggctgcgggttcccccggcggct
tctcctctgctcccggccccggggctccgcggccactgctgcccgctcagccgcagccac
EXON 2  156 bp
cctcccctcagaatagcccacacttgtctttaggataccttgtaagctgttgcctctgtt
tataatgattttgaacgttgggaacatgtttgaggttatcctgccaaatatgtgcccttg
agagagagaaagttgatgactttgagtccttataatggcttctggcctttgcccccccag
GTTGGAGTTGCTGTGGGTGAGCTGCTGTGGTCTGTAGCCAAGCATGCTGTGGTCGGATCT
GCCCAGCCGTGGAACAGAAACATTTGCTGGATGGAAAATCCATAAAAGAAAGCTCCTGTG
AAAAGCTGAGGCTGACAATAATTTAAGCAAAATCAG
gttagtataagtaagagaggctggataaagcggattgggccggatagggaaaagttgttt
tgttccttccaggctcattttggagaccaccccaaatgattattttcagttatttgtgag
agtcccagcatgtgtaaatggcagatacatgctgatagccttttgtgtatagtgtaatga
EXON 3  112 bp
tagaaagccttgttagtatattatgaaagaaaaatagtttacatttctcatcatttaagg
atcccaatgacatcgttattttgttgatgcagagatactctgaatgacagtcgggtattt
tgatttttcatttctgatatgattttgaatttaaaatttttgtctctacacactttctag
ATCGATCTCTTTGGGCTGCCTGACCTCCTTGGGTGCTTGCTATTAATTAACAGACTTTGT
GGGGAAAAAAAGGAGCTTGCCTTCTGAGCTTTGTACCAAAGACCTGGGAAAA
gtaagtaattttaaacttgcttttaaaaaattctgttatacctctctcagaaagttaaca
atagatccatggctttttactttctttcattcctggcttaataaattttatatgttttca
tggatttgtaacatggaaggagactcaggaaacctctttgtgtaaaaaaaaaaaacttgc
EXON 4  98 bp
ggcctgcctgcggtgacagggagacttcatcttgcatgcgactatgaataattcataaac
atggttatctggaaatatgtggtcatcattagcattttaatgaaaaaaaaaaaaaaaaag
ctgtcattatcctaagtctctgttttgtttctaccttttttttttctccccccaccacag
CTAACCATCTCAGTCTTTCCTGAGGACTTGGGAACTGCCGAGGCCTCTGCCAATGTGTTG
ACTGTCGCTATGGGCTCACTGTTGTCCAGGCAGCTCAT
gtatgtatgggatcagtctctctcttgcttttttctctttaattttcattgtagaatatc
acaagagtactgaattggtaaaagctttaaaggtttaaataaggatgtttagaaatacaa
gagaatggattgctctagggtaagttttaaatattgcatggtaagaaatgttatctaaat
EXON 5  69 bp
ttcaagtttcaatcaaaagtggtatgaccaactataaacaaacaaaaatttggacattat
ctgccaaaatttgtttggtatatataacagcttttggagagattttcactgctatgcttt
tctttcttttatgctttgttatttggagttttaatttctcaaatgatcccttctttttag
ATTTCAAATTATAACCTATTTCCTGCACCATTGCTGACGCCTGGTGATCCATGTCAGAAG
TACTTCCAG
gtcagatacattttctcatatttcaatgcagagaagcagttgaatattaaaacttaaaaa
aagataatgtttaatgttaaacttatgatttgctaaaataacatgttttttaatttcatt
gttcttcactaatgtaatagaaaaatgaatcttggccgggcgcggtggctcacgcctgta
EXON 6  816 bp
ttgctcctgtttaatataggaacaaatggtgaaataaagaggaaaatgggtccattctat
gagaatgtatgtgcagtggaagcatttcttcttttagttttctatataaaaatatttact
cacactgtatactaagtagtttaatcatggcaggtgtctaatgactttttttttccccag
CTGACTCAGGTGTTGACACCTTGGCAGTGTTTATGGCCAGCAGCGGAACTACAGACGTCA
CAAATCGGAACAGCCCAGCCACACCACCAAACACCCTTAACCTCCGATCCTCCCACAATG
AACTGTTGAACGCTGAAATAAAACACACAGAAACCAAGAACAGCACACCTCCCAAATGCA
GGAAAAAATATGCACTAACTAACATCCAGGCGGCCATGGGCCTCTCGGATCCAGCTGCAC
AGCCCCTGCTGGGAAATGGCTCTGCCAACATCAAGCTGGTGAAAAATGGGGAGAACCAGC
TCCGTAAGGCTGCAGAGCAAGGGCAGCAGGACCCCAACAAAAACCTGAGCCCCACTGCAG
TCATCAACATAACTTCTGAGAAGTTAGAGGGTAAAGAGCCCCACCCACAGGATTCCTCGA
GCTGTGAGATTTTACCCTCCCAGCCCAGGAGAACTAAGAGCTTCCTAAATTACTATGCAG
ATCTGGAAACCTCAGCCAGAGAACTAGAGCAGAACCGAGGCAATCACCATGGGACTGCGG
AAGAGAAATCCCAGCCAGTCCAGGGCCAGGCCTCCACCATCATTGGGAATGGCGATTTGC
TGCTGCAGAAACCAAACAGACCCCAGTCCAGCCCTGAAGACGGCCAAGTAGCCACAGTGT
CATCCAGCCCAGAAACCAAGAAGGATCATCCGAAAACAGGGGCCAAAACCGACTGTGCAC
TGCACCGGATCCAGAACCTGGCACCGAGCGATGAGGAGTCCAGCTGGACAACGTTGTCCC
AAGACAGTGCCTCACCCAGCTCCCCGGATGAAACAG
gtacccctggggaaggcgtagcctcagctggcacttttttttttttatcttttcaactat
tggagtaaatctctagactgaccaaaaatgtccattatgcagagaggaacgtgagcctct
tgcggtaaaattgggcaatttatttgcaaaatattactgcattcctcaaccatattttag
EXON 7  206 bp
gttttaccaagtacagccacacacatcagtatggatggatttcacaaacataccaggaag
aactaatcatttggactatggacacgtctgcctttggggttcacctgacgaatagtgctg
acattcttttaataaaattctctctttctccccccgccccgccccccaatttttcagcag
ATATATGGAGTGATCACTCATTTCAGACTGATCCAGATTTGCCGCCTGGCTGGAAAAGAG
TCAGTGACATTGCCGGGACCTATTATTGGCACATCCCAACAGGAACGACTCAGTGGGAAC
GGCCCGTCTCCATCCCAGCAGATCTCCAGGGTTCTAGGAAAGGGTCACTTAGTTCTGTAA
CGCCATCTCCCACCCCAGAGAACGAG
gtaaaacggagtgtctttttaccagcttagtagaatagatgtaacttgtggtttctcttt
acactggttgcttctgccccaacaggtcatcaaggtaagctttttgattattgtgcatgt
tgcatttgaaatctcagtaatgcttcctcttagtaaatagtgttaatatccatctttcag
EXON 8  86 bp
gttttgtaagaacaggagtttgcaccagtcagcattcaacagtccttgcatgcctttctc
tgcctaagctcacgtacactctctgcctcttgctgggaagacgtttctcccctttgatat
ttgaggcaatgaatggtcttctcccccattgtacattaacaaggttctattttcctctag
GATTTGCATGCAGCCACTGTTAACCCGGACCCCAGTTTAAAAGAGTTTGAAGGAGCAACC
CTACGCTATGCATCTTTGAAACTCAG
gtaggacattagtaggatcgacctgctgtcaatgtatggctttgtgcagatagtttgcaa
tagaattctaagtccacttttctgtttttctgcctagaaatgccccacaccctgatgatg
atgattcttgtagtatcaacagtgacccagaagccaaggtttgtaaagacttgctttcag
EXON 9  61 bp
ttgcatgcagccactgttaacccggaccccagtttaaaagagtttgaaggagcaacccta
cgctatgcatctttgaaactcaggtaggacattagtaggatcgacctgctgtcaatgtat
ggctttgtgcagatagtttgcaatagaattctaagtccacttttctgtttttctgcctag
AAATGCCCCACACCCTGATGATGATGATTCTTGTAGTATCAACAGTGACCCAGAAGCCAA
G
gtttgtaaagacttgctttcagccaccaggttatattcttagatccaaataatgactttg
gatcattgtccagtttttacaaaccatcaacccagagccatttaataagtaattatccct
caattttctctttcctaatctccctgacacttgaagaaaacccctaggctaagttaggtt
EXON 10  147 bp
agttacaatttaatttccagcaatagaggatttgttaactcaattagatgattgaacata
atgaagcaaataaaggtgcattaagtgtagtaccttttagttgcgggaggggagtagtgt
aaactgatatgattgaccaaaccatggagtgacttcttgtcctctttcactgtcttccag
TGTTTTGCTGTGCGTTCTCTGGGATGGGTAGAGATGGCAGAAGAGGACCTCGCCCCCGGT
AAAAGTAGTGTTGCGGTCAACAACTGCATCAGGCAACTTTCCTACTGCAAAAATGACATC
CGAGACACAGTCGGGATTTGGGGAGAG
gtaagtggcatgtagaatgatgcacggcaggctgtttacgttctcctgcatttcaggaag
ccccacagctcagtgacacatggtactgaggggctccgaggtgttcatcaggtgcctttt
cccattaatgcaggaagtgtaggcatggtacccccgtgtgactgatcccttagcactgcc
EXON 11  128 bp
gaggggaaactgaaagatatcaatattcttgtccagaaaggaagtttcttaggcagacaa
attacagaccccagggtggcttcttctgatggttgacacggcattcctagatggccacac
acacgattaggctttccagcctgcatgaagaagacagcgtgttttctcgttgtgtcccag
GGGAAAGACATGTACCTGATCCTGGAGAATGACATGCTCAGCCTGGTGGACCCCATGGAC
CGCAGCGTGCTGCACTCGCAGCCCATCGTCAGCATCCGCGTGTGGGGCGTGGGCCGCGAC
AATGGCCG
gtgagtccctgggtggggcagtctgggtcacctcacccgtgtccctggtctagctgaaca
ccaaagcatgggctcgcagcatttcacggaatacgaaactcatgtagcttctatatagaa
atgtgaaaaatgaaagcttgtctctagttccctgcctcttaaagacttcaaactgcttcc
EXON 12  115 bp
atttctaattgtcataaaactatatgttaggaagctattgtaatttaatttttcttttaa
tcattgcatacattgtttaccattgacacgctggctgctagctcagttaacttcataact
aaagtatgtgttggtaatcagcttctcttactaatggactgatacattttgcttgcacag
GGATTTTGCTTATGTAGCAAGAGATAAAGATACAAGAATTTTGAAATGTCATGTATTTCG
ATGTGACACACCAGCAAAAGCCATTGCCACAAGTCTCCACGAGATCTGCTCCAAG
gtaaggtgggtcagggcagtatgggccgcctctctctttttttcttgctgcataaaagga
tgtggaagggcgggggagtgggcacatcaacctgcagttgagctcagggagaagtaggca
gattgttcagccagagtcattaaagtattcttgctgcgggccaggcatcgctcttgagta
EXON 13  88 bp
aatgagtggaattcctcaacaaaatatgtagccccagagatgcaggggtgggacttcagg
caatagactaaagctgatctaacttggaagtgaagtcaacctagacactttacaggctgg
aatagctgaagacatgggggcttgaacccacgctccaaagctgcactttttcccccttag
ATTATGGCTGAACGGAAGAATGCCAAAGCGCTGGCCTGCAGCTCCTTACAGGAAAGGGCC
AATGTGAACCTCGATGTCCCTTTGCAAG
gtaagtcagtggcacctcatgtcttcattatggccctgtccctcctggtccaggactgaa
ggctctcagatggttctctggtatttcaagtctccttaaagagcacactcaactcagtaa
gcacaagttgagcctgcacgctgggtctcacagaggcacagagttgattttgcatcacta
EXON 14  84 bp
agagccccaatatctggagtaatgctgctcttgtagaatagttgttacatttacatccag
aaacatagggcgttatggcacagggcgtgtcctgagcattcagatgatgcagagccacgg
ctgttgtgtacatgtgtgttggaaccactgagaaagatgtgttgcttttgttccctgtag
TAGATTTTCCAACACCAAAGACTGAGCTGGTCCAGAAGTTCCACGTGCAGTACTTGGGCA
TGTTACCTGTAGACAAACCAGTCG
gtatgtgaaatgtttattgtctttccactttgcaagtgtgcgggagctcacaggaggcgt
tcgccctccgaggagggtgaggtctgctgtttactctcacgccttgtcttgaatcaaact
gtcacactgtcacctgccagagaacataaacggtcctgatcaaaagatgagtagagggac
EXON 15  116 bp
tgagccactacgcccggccagaagctggtatttcattcctgttgagcaaacatgagaatg
aagtgtcctgtctattaaaaaaagatcagtctgggcgtagctgttattggtgatttgggc
ccacatttgagtgtggtaagtggctttaggacactttaaattatccttttctgtccccag
GAATGGATATTTTGAACAGTGCCATAGAAAATCTTATGACCTCATCCAACAAGGAGGACT
GGCTGTCAGTGAACATGAACGTGGCTGATGCCACTGTGACTGTCATCAGTGAAAAG
gtgagaaggaatcttcgatgacattggtgtgtcttatacagtgagtataagatacagtgg
ttttctgtggaacttaggaacatagtcaaggccggagttgtgcatccttgtgattaagat
ggcctacatttgaaagatttggccctttgtctgggtctaaatctgtgcatacctctgttt
EXON 16  180 bp
ggtagccatgcagtgatggcctcttcagacatttgggcaaggttccgcctttcgagaaaa
acacaggtcctttctgaattcggcctggctatactttctgaatgccagttcctatgtgct
gccactcttaagcttgatcctgggatctcctgattggatgccgcataatgtctcttgcag
AATGAAGAGGAAGTCTTAGTGGAATGTCGTGTGCGATTCCTGTCCTTCATGGGTGTTGGG
AAGGACGTCCACACATTTGCCTTCATCATGGACACGGGGAACCAGCGCTTTGAGTGCCAC
GTTTTCTGGTGCGAGCCTAATGCTGGTAACGTGTCTGAGGCGGTGCAGGCCGCCTGCATG

gtgagttatcccggtacaggctgttgagccctcccgcctctgctcatctctaatatgcca
tacattatagcagaatcactcacggaaatgaaaaaagtcgaatccctaaagtaatgcttt
actttataacgccgtcattcctagggccagaatcagttatgataaacagattacatctcc
EXON 17  1652 bp
taatcttttaggagaatttaaagcactcacattcagagaaaaataactcttggatttatg
tttaggaactaggtcgttaacctttgggagtcaatgtattatgggtcatgacttaaagtc
atattaaagatgaaataatatgttgttaattaccttaaaacacgttttgttttatttcag
TTACGATATCAGAAGTGCTTGGTAGCCAGGCCGCCTTCTCAGAAAGTTCGACCACCTCCA
CCGCCAGCAGATTCAGTAACCAGAAGAGTCACAACCAATGTAAAACGAGGGGTCTTATCC
CTCATTGACACTTTGAAACAGAAACGCCCTGTCACCGAAATGCCATAGCTGCACATGCAA
AAGGACTCGGCTATTTACCTGAAGATTGACTAGCTACACTAAAGAAAATGAACTCCGCCA
TCCGACCTTCCATCCAGTTGCTGATGCTTTGTCTTCAGAGAATTTACCCTTAACCAAGCA
GTGTTAGACAAGCATGTTCTCTCGTCTTGCCACCATCATGTGATATGAAAAGAAGCATGA
ATAATTTTTTTTGCTGTAAGTTACATCATGCGCAGTGGAAGGTCTTTTTCTTATTGTAAA
TATTGTGAACATTACTTAACTTCACACACACACAGAGAAGAGTGTGGCCCCACCCCTCCT
AGTGAACTAACGCTGCGTCCTTGGAATGAATGATGCGTGAGTTAGTTTCACTGTCTTCTT
GGCTGGACCTGTCACAAGCAACCTTTAAGTCCTACAGCACTTTGCCCTGTTTTCAACATT
GGAGTAGGCACTGCATAGCAGATACCATTGAATTGCTGTAAAAATAGGATGGCGAGTTTG
TGTTTTAATTTTTCATAAAATTGAACCTGTTGGTTGACAAAATTGGCTGTTGGCATCAGT
ATAGAAACCAACTGGCAGCTTTCCCTGACAAGCTCTTTGACACATGGACACCATTTCATG
TCTACAGCTGTTTGTGGGATGTTGGAAAAAAATGAAACTTCAAAATTGATGAAAAACTAA
ATTCGAGGAATTAAAATCGAACAAAACATAGCCTTTCTTTTCCGATGGTTTTCAAACTGA
TTATTTTTAAAAGAGATTAATAAAATCATAATGCATTTTGGGTGGGACATATTTCAAACT
TCTGCCTTATATTGTACGGTGCAGCTAGAGAATTATAGTTCACTATGGCCATTCTCTACA
TAAACATTAAGATGAAATACTCCTCATCAGCCTTTCATCCTTAGTTTGAGAATTAGCTGA
TATGCAATTTGAAGTTGAGGAAATATCATTGATATTTCTATCATGCACGATTATTTTAGA
TTTCTACCACCGTGTGATTTTTGCTAGTCCATGTGCTAGAGGTAAACGTTCTGCTGGAAT
TCTGCATCCAGCTCTATCCCCCTCTGATGCTTTTTGCCCAGAAAGCTGTCTGTCCATCAT
GTATTGTCCATGGCAACAAATTACATTAGGTTGAACCTTTCCTTGATTTTATGTATTTAA
TATTAGAATTTGTTGGACTCAACTAGATATATTTTTTAATTTATATTTTTTCCATTTTAC
TTTGAAGATTTGAAATGTTCATACCTGAGCAAAGTCTACACAGGAGTAATGGACTGTTTA
ACAAGTTTCCCAAAACAGCATTTTCCTGCTCCTTCGTATGTAGGTGAGAAACTTAGCTGG
AAAGACATACAAATTTAGACTCTCGTTGACATTGTCGTTTTAAAAGGAAGTTGCTAAGGC
GATCAATCTCAATATTAGTCTTGTTTACTTCTTCTTAATGTCAAAATTAACATTTACAAC
ATCCAATTATAAAAGTAATGCTTTATGTTTAT
acactgctatgtacttgtcaaaatggtttccacattcttatcacatctgagccttaccag
gtagagaaggtactaaatacactttagaagtaaaaatatgaagtaccgagaggctaaacc
cactggcctaagatctcaccaaagttcatgaaaaccaggactaggacccacggctcccaa