Gene ABCE1 Variant 1
DNA : 30.84 KbNT_016606
mRNA : 3519 bp NM_002940
CDS : 1800 bp NP_002931
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  86 bp
ttctcggcacctccagcagctggcttcgccaacggcgttgaacaagggtcgcagctcaat
gacgtcatatctccctacctacctccagggttccgcctcacgctctatgtcgcgcgcgcg
cactacgtcctatggcttgcgcgtgcggcggctgggcaccgccattttggccggtggccg
TGAGAACACGCTGTGTGGCTGAAAAGTGAAGGCAAGAGCTGATTTGGCCTCTGTGCTCCC
CTCCGCAAGGGGATCGTTTTCTCCAG
gtacgtgaatagcccggagaggtttggccgttagctgccatctgccaggttggaaagaat
gtagggacgttctccgagagcctttggttaggccttaggtggcggagacagcagcagcgc
gtggcagcggttcctgcgggacagctggaactgatggagcgcgggcgacgccgagagctt
EXON 2  130 bp
cccaaccttactagattatagattattttacaatttttacatttgtcaaaatttatattt
tttttttgcagataatcatttcatctccatataatgatcatttatgttttcctgtctttc
atgtatgcaaattagttcccttaactaatggcattaaatttgttgatttttctttcatag
AAGAGCTGGATATTCTTTCGCCCAGTTATGGCAGACAAGTTAACGAGAATTGCTATTGTC
AACCATGACAAATGTAAACCTAAGAAATGTCGACAGGAATGCAAAAAGAGTTGTCCTGTA
GTTCGAATGG
gtaagctgttctgtggatcatttaagtataaaagaaaaccatgaaagaaatcaactggtt
tgataattctttacggacattaacataaactttgtgttcaccattagtttcataaaactg
tgaagacaagaaaagtagtttgttctaaatttcttttattgctttgtgactgaaggatca
EXON 3  86 bp
aaatctgtccccacaaagcactgatttaagacattatctcaaatgtatttctttgtgtgg
cctttgtttttgaaaatctgcttctgtatggaaatttagaaccagcattgcctaaataac
agtgttcggaaaattagaagatcaaaggaaatggcttaattatatcttttcctttaccag
GAAAATTATGCATAGAGGTTACACCCCAGAGCAAAATAGCATGGATTTCCGAAACTCTTT
GTATTGGTTGTGGTATCTGTATTAAG
gtaagtaatattttatttactggatcaaacgtgtaacctaaaactgaaatctgaaaattc
tggatactatgctataactactttaagtgaggcaaagtataaagcaaatgaatagagaat
gtaaatttaggaaagtggtattctaatatcagtgacattgttgcttttttaaataaatta
EXON 4  98 bp
attctaatgttcaaggaaccttttattttaagtaaatagtagaaggaaatgaaacaacat
ttcacatctttatgaaatcatgtttagaagattgcttataaaaatatttttaatccattt
tagttatgtgtatatgtctacaaattaatacaaaaattaattctttactttaaataacag
AAATGCCCCTTTGGCGCCTTATCAATTGTCAATCTACCAAGCAACTTGGAAAAAGAAACC
ACACATCGATATTGTGCCAATGCCTTCAAACTTCACAG
gtatattttcacatcaggattcctcttctgtcaagttaagagtaaaatacatttgggatt
ttaagagaagtgcagaaattggggggaaatgctattaaccagtcactaaaggaaaataca
atattataacatcatgcagaatcatactgcatatgtctgtggttcattctggctaacatt
EXON 5  118 bp
ctaatagccattaatcttggctgtttttttcctaatagccagtaatatctggcatatgtt
tcttagcttattaatggatggttgtgaagtgcaggtgcattaaaatatatcattctgatg
ttatgtggctttttctgtgtaaatctgagttgttttattatttttgtatacttgtaacag
GTTGCCTATCCCTCGTCCAGGTGAAGTTTTGGGATTAGTTGGAACTAATGGTATTGGAAA
GTCAACTGCTTTAAAAATTTTAGCAGGAAAACAAAAGCCAAACCTTGGAAAGTACGAT
gtatgtattatcaccttgtaaaaattaatatcatgagtcagttttatgagattttggggg
gatgatatgtatatttttaaaatattcttattttcaaaattatttatggaattaatgctg
agaaatttataaacaaagctcttttgtacttttgaactaaaaatctgttaatgttactta
EXON 6  138 bp
tgttttctttctttgctgctatagggaaatgagacttttattaattatgttcgcctccaa
ccttaagttaaaagccacaagtgttctatttgcatatataatctatttcctgtagcattc
atcctctttgtcattgtattattaaattcacatgattctgtattttttttttttttttag
GATCCTCCTGACTGGCAGGAGATTTTGACTTATTTCCGTGGATCTGAATTACAAAATTAC
TTTACAAAGATTCTAGAAGATGACCTAAAAGCCATCATCAAACCTCAATATGTAGACCAG
ATTCCTAAGGCTGCAAAG
gtcggtttttgatagagggaacttaacggatattagtagaagtataaaagatatatcaaa
ataaacttgttttactttgtgattctttttaatattgaaagaaaatagtaactgtttttg
gtatattgtggcaggggacagtgggatctattttggaccgaaaagatgaaacaaagacac
EXON 7  70 bp
catcatcaaacctcaatatgtagaccagattcctaaggctgcaaaggtcggtttttgata
gagggaacttaacggatattagtagaagtataaaagatatatcaaaataaacttgtttta
ctttgtgattctttttaatattgaaagaaaatagtaactgtttttggtatattgtggcag
GGGACAGTGGGATCTATTTTGGACCGAAAAGATGAAACAAAGACACAGGCAATTGTATGT
CAGCAGCTTG
gtaagtgtttattttttgtttgtgtgaatatatatttatttattttttgagacggagttt
cgctcttgttgcccaggctggggtgcaatgatgcaacctctgcttaccacaacctctgcc
tcccgggttcaagcgatactcctgcctcagcctcccaagtagctgggattacaggcatgt
EXON 8  97 bp
ctgaacttaagtgatgaaagtacacatctttatgtggattactgaaaatctccagtaatt
gttatatttaaacaattttcaactgaaatagcattcaaacttcaaatgatgacatgcagt
atactttttacctggaagaggtgaaatacattgagcacaatgcctctatgttctttgtag
ATTTAACCCACCTAAAAGAACGAAATGTTGAAGATCTTTCAGGAGGAGAGTTGCAGAGAT
TTGCTTGTGCTGTCGTTTGCATACAGAAAGCTGATAT
gtaggttactttacaatttttgtttatcttcatccgtattgtagagttttcagttgtgat
gctgctaatagaggaatggttttgagagaaattaatagaaatagtatctaagttcctaat
ttcgaggtaagatgttgaagcagttgtgtatccactactcattttccctgttatattcac
EXON 9  90 bp
tctacttctgaacagaatacagaaatttttaccattacaagtagactcttcattactatt
ggagatttgtgttgtggttaactcaaaagctcttgatactacagtgctttaaaatagtat
gtaaggtagaatgtcttgtctttcaaacttatatttgctttttttttttttttttcatag
TTTCATGTTTGATGAGCCTTCTAGTTACCTAGATGTCAAGCAGCGTTTAAAGGCTGCTAT
TACTATACGATCTCTAATAAATCCAGATAG
gtaagtagagatctggcatattactgtgttgttttgtttggagatttttacagatttcta
aggattaaacactgggactgtcaatgtgatgtacatattttttatcttggttgtttatag
ctgccacctaaatttacctttctttacctagaacagaggttctcaatgcaagattcattt
EXON 10  122 bp
gttcaggaaaacatttttaaatatgagcattgataatgagccttactaaaaatgttttat
ggcttttgcttcttatgtctttatgcttaaattttattagatgtatctctttttctgaaa
tttccaactattaaaaatagttatgtaagagttttaactaaaatctggtttgattttcag
ATATATCATTGTGGTGGAACATGATCTAAGTGTATTAGACTATCTCTCCGACTTCATCTG
CTGTTTATATGGTGTACCAAGCGCCTATGGAGTTGTCACTATGCCTTTTAGTGTAAGAGA
AG
gtaacttgaaaaacttttttcacatatgctgtattctcttctactctaatgcttataaac
tacattattgatattaagtagttttacattggtctgatatcatccaaaactctagttcct
tggaatttaatcactgagcatataaggttatatatatcagttgttatacaaaatatattt
EXON 11  222 bp
tgaattatttaaacttacattaaatatatatagttttttaagttacttctttatatgcag
accaacatgttagcaaaaatccacagaaatttaaagtatatagtctatagattgctccca
agagagcttaggattttggctctaatgatttctcccggttgacaattttcttcccaacag
GCATAAACATTTTTTTGGATGGCTATGTTCCAACAGAAAACTTGAGATTCAGAGATGCAT
CACTTGTTTTTAAAGTGGCTGAGACAGCAAATGAAGAAGAAGTTAAAAAGATGTGTATGT
ATAAATATCCAGGAATGAAGAAAAAAATGGGAGAATTTGAGCTAGCAATTGTAGCTGGAG
AGTTTACAGATTCTGAAATTATGGTGATGCTGGGGGAAAATG
gtaagttttctgttttgtgataagtaaaaatcttcctgtttatctagtaaattagtttta
actgttttgtggaaaaatttgaatcatatgttatagggctagaagcagagttttatttaa
acccacaaatttcttagtgtactttcacatttttttggcattgtgtaattcaatttcact
EXON 12  60 bp
atgacacttcagaggtgagccatgaaagacttaagtatttttctatataaacttcagaat
tcaataatgtcagtgtatatctttaaaacaaatttctcagttaaaaccaaataggacata
gtgatttactttaaacgtcaagcatctttcagatcaaactgtcatatgttgtgttgccag
GAACGGGTAAAACGACATTTATCAGAATGCTTGCTGGAAGACTTAAACCTGATGAAGGAG

gtacatttgtaactgttgagtctttttactctgttttacacagtaaactttaaagatctg
ggcagtttttagtgtcttatgtatttcattattttgcaggagaagtaccagttctaaatg
tcagttataagccacagaaaattagtcccaaatcaactgtgagttattattttttatatg
EXON 13  59 bp
tgtcatatgttgtgttgccaggaacgggtaaaacgacatttatcagaatgcttgctggaa
gacttaaacctgatgaaggaggtacatttgtaactgttgagtctttttactctgttttac
acagtaaactttaaagatctgggcagtttttagtgtcttatgtatttcattattttgcag
GAGAAGTACCAGTTCTAAATGTCAGTTATAAGCCACAGAAAATTAGTCCCAAATCAACT
gtgagttattattttttatatggttactaaagaaaattttgtatatatgcctatagcttt
catcttttactatattaaaatttttctccaaattagattctatacagttttattgatagt
tgcaaacaaatgtattaagagtccaatccttgattcatatccactgctaagaaagtgctt
EXON 14  111 bp
acatgatgggttttgaatagaaaatctcaaaacatgtcatagatggtggatacacattga
tatctgttggtggcaaattgatatacttttattctgaagcttaactttgtcaagattcat
aaatagaagagttctatagtgaaagtttatcatttaaatacttttttatattaaaaacag
GGAAGTGTTCGCCAGTTACTACATGAAAAGATAAGAGATGCTTATACTCACCCACAATTT
GTGACCGATGTAATGAAGCCTCTGCAAATTGAAAACATCATTGATCAAGAG
gtactttaacataattttttttatttttttattattttgaattttggatgcctttacatg
gtttgctaaactcctccaattaggtgcagacattatctggtggtgaactacagcgagtag
ctttagccctttgcttgggcaaacctgctgatgtctatttaattgatgaaccatctgcat
EXON 15  143 bp
gttactacatgaaaagataagagatgcttatactcacccacaatttgtgaccgatgtaat
gaagcctctgcaaattgaaaacatcattgatcaagaggtactttaacataatttttttta
tttttttattattttgaattttggatgcctttacatggtttgctaaactcctccaattag
GTGCAGACATTATCTGGTGGTGAACTACAGCGAGTAGCTTTAGCCCTTTGCTTGGGCAAA
CCTGCTGATGTCTATTTAATTGATGAACCATCTGCATATTTGGATTCTGAGCAAAGACTG
ATGGCAGCTCGAGTTGTCAAACG
gtaaatatcttgctcctagccatattttgattatgtatactgtcctacaagtgtgcttaa
tataacagtcgaatgttttatgatagaaagctataagatttcaaaatcattgtgttttag
tttcatactccatgcaaaaaagacagcctttgttgtggaacatgacttcatcatggccac
EXON 16  123 bp
tgaaccatctgcatatttggattctgagcaaagactgatggcagctcgagttgtcaaacg
gtaaatatcttgctcctagccatattttgattatgtatactgtcctacaagtgtgcttaa
tataacagtcgaatgttttatgatagaaagctataagatttcaaaatcattgtgttttag
TTTCATACTCCATGCAAAAAAGACAGCCTTTGTTGTGGAACATGACTTCATCATGGCCAC
CTATCTAGCGGATCGCGTCATCGTTTTTGATGGTGTTCCATCTAAGAACACAGTTGCAAA
CAG
gtaaaattactttttaatatgttcaaagtaattcattttaaattttccagtaaatagtaa
agtcactcactttaatttttaaaaaatgaaagctagaaattctagacttgattctgtgac
tcctgagatcattggtattggggactggatgggaccatgtggaagagtagtgtttaggct
EXON 17  112 bp
agtccaagcaaagctatttctgaacacaggatttgtaatatgctgttattatactgttat
ccagatgatttatgattggggaatttgaggtaatagtaattcttaatacccttcctctca
aaaggtagttacatttctgaagtaaaatttaatcaaaattgatttttttttttctcttag
TCCTCAAACCCTTTTGGCTGGCATGAATAAATTTTTGTCTCAGCTTGAAATTACATTCAG
AAGAGATCCAAACAACTATAGGCCACGAATAAACAAACTTAATTCAATTAAG
gtatgtagaaaagttgtcttaaatcatggattactgatctcagtataaacacttgaaagg
ctatttaaaaatcaataacatatggctgggcacagtggctcacacctgtgattcaagcac
ttttgggaggccaaggcaggcagatcacttgaggtcacgagtttgagaccagcctggcca
EXON 18  1654 bp
aggtagttatctttcctttgagcagtggacccaggaatatccagaaacagatggtatgtg
cagaacaggttgtacaggcactgttttaagcacagctaagtaataccatgagtgaaagtc
tacttttacctatagtagaatcgtgttgctgatttttgtggcttctgttttcttttttag
GATGTAGAACAAAAGAAGAGTGGAAACTACTTTTTCTTGGATGATTAGACTGACTCTGAG
AATATTGATAAGCCATTTATTAAAAGGAGTATTTACTAGAATTTTTTGTCATATAAAACT
TGAATCAGGATTTTATGCCCCACATACTCTGGAACTTGAAGTATAATATACTTAATATAA
CATAAAAAGCCAGTTGGGTTCTAAATTGTAGTTGAAACACAGAAAATGCCACTTTTCTGT
TCCTGAAGAGGCTCTTTTGTGCATAATATTCTAAAATGAAGACATTTCAAGCTATACAAA
TTACTTCCAAGTTTTCATGATGTATGGGAAGATTTTCAGTAGGTGTATTATATTCACGGT
ACCAAATGCTGACCAGTGTTGCTCCATTTTTTAAATCTTGAAAAGGGTTTCTGTACTTAC
CTGGTTTGCCAAGTATGCCAGTGTAATGAAACTGCCCTTATTTTAAAAGCCAGTCAAAGA
TTCCACTGATTGACATTTGATAAATAAACATCAGGATTATGTTTATTGTTTGTTTTCAGT
CTTTGCACTATATTACCAGTATATGGTTTCCGAGGAAGATTATCTACTGCAAAACACCAC
TGTTGGAAAAATAGGTATTTTTAAATTGTTTTTAATCTTTTTTGGTGCTTTTAAACATGT
TTAGCAAAAACCAATTCAGTTCCATTCCCCGCAAAAAACCCCTAACTTTACTCTGAACTT
TTTTTGTTTTTGCATTCCATGAGGTTCTGTATTCAGTCATTCTCTAGGTAATGTCATTTT
TGTACACATATATTTATATAATCACTGATTGAGATTTAGGAAAAAGCATTTCTAAAGAAT
ATTTGCTTCCCTTAGAACTACAGACTCGAAATCTTTAAAGATGGTGCCTAAGCATCTATG
TATTTTTTTTAAGTTCCACAGATTTTTCTGTTGGGCAGCCAAGGATTATAAACCACTTCC
CTAAAGGCAACATTAATGCAAAAGTCCCCAGATGGCAATACAAAGTATCCCCTGGTACCA
CATATATTCATTTGTGAGTTTGGATATAGAGCACATTATCTAAACCATTTTGTAGTTCCA
AAAACCCATCTAAATTTCTTGAGTTCCTGAATTTTGAACAGGATTACCTGGAGCCTGGAG
CCACTTTAAGTTGTACTTCTGACTAAACTGGAATTATGAGTGAGGAAGAGTGTTTACTAA
ATAAATGACTGGGGCAAGCAAAATTGAGGAGGAAATTAGAAACTGTTTGACAAACTTTAA
GAGCTACTTGAAATAACAGAAGTCTTGATTAATATGCAAATAATGGCTAGAAAGTATGGT
TTAACTGGACCCTATTATGCCTTTTAAAAATAATTTCAGTAACCCATAAATACATGTTGT
AAAAAATTCAAATATACAGAATGGAATAAAAAAATGATCTCCCTTTATTACCCTCCCAAA
GGTTACCAGCGTTTGAATTTAATAATGTATATTCTTTCATGCTTTTTTCTGTGCACTTAC
CTAAGTGTGAATATGTAAAGGGTTTGTTTTGTATACAAATGGGATTATACTAAAATAAGT
AATGCCTATTTTTAAGGATAGGTTAAATTTGTGAATGATCATTTCAAATATATTGAATAA
AATAAGCAAAAGCTATTGTTATTTACTGATCCTG
gattgtcttaaagaaagtacttgtgatataagagcacagttctacttactgctaatgaca
gaatatgtattaaacgtattttcatgtaaatgaaatctttaaaatatgtatcttaaaatt
ttacatagcaacagaaaggcctacaattgctaacacaagaaaaatacttataaaatcagt