--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (90874 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (35 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6693       6867   2   Internal    175    84        Good
atgagctggaagaggaactgactttgatctacctttttaagaaattgtgcgggtcagaca
gaacacatttgtatgtgttttggtgttaaagagttgtccagagcacatgaagctgaactg
ggacttcaacattttttcaaggttttacatttgctctttttttcctgtctccttcctcag
CTGTCTGCTTTTCTGTGGAGACTGCGGGTTGCAGACACCAGCAGCCCCCTATTGCTGCAC
GTCAGGTGTCCTCCACCTCAGTACTGTGGACATCTCGGGCCGCATAGCCCTGTTGCGCGG
GCATCCTGTGCGTTGCAGGAGATGCAGCAGCATCCATGACCGCAACCCATCAGAG
gtcagggtccgccccctagtggtggtaataaaaaatgcttccagatgaggttaagtgtcc
ctggggaacaaaatcctccccatttgagaaccgctgttctagtccacgggcatctctggt
ccttactgtactcagattttccctagtgtctgatgctattgatttctggcttctcagagg

Exon  2 +       8127       8933   0     Single    807    78        Good
tgccttctgtgacctgaattattataaaaacatcataaattgcttacaaagaaaatcaga
ccccacaaagctgtagaggtcctggcatacctatcctaggttttaaatgtaattgctttt
tctttcttttttcttttttttaataccatagtgttctaagaacggaagcatctgggctgg
ATGGAATTTAGCATCAAGCAGAGTCCCCTTTCTGTTCAGAGTGTTGTAAAGTGCATAAAG
ATGAAGCAGGCACCAGAAATCCTCGGCAGTGCCAACGGGAAGACTCCGAGCTGCGAGGTG
AACCGCGAGTGTTCTGTGTTCCTCAGCAAAGCCCAGCTCTCCAGTAGCCTGCAGGAGGGG
GTCATGCAGAAGTTTAACGGCCACGACGCCCTGCCCTTTATTCCAGCCGACAAGCTGAAA
GATCTTACTTCCCGGGTGTTTAATGGAGAACCCGGCGCACACGATGCCAAACTGCGTTTT
GAGTCCCAGGAAATGAAAGGGATTGGGACACCCCCTAACACTACCCCTATCAAAAATGGC
TCTCCAGAAATTAAGCTGAAAATCACCAAAACATACATGAATGGGAAGCCTCTCTTTGAA
TCTTCCATTTGTGGTGACAGTGCTGCTGATGTGTCTCAGTCAGAAGAAAATGGACAAAAA
CCAGAAAACAAGGCGAGAAGGAACAGGAAGAGGAGCATAAAATATGACTCCTTGCTGGAG
CAGGGCCTTGTCGAAGCAGCTCTTGTGTCTAAGATCTCAAGTCCTTCAGATAAAAAGGTA
TTTAGGAGACGTTGTGTAAGGGGTCATGTGACCTTGAGCAGTGAGCATGGCCACCCTATG
AGGGCACCTGCACGAGTACTGGGGCGGGCGGAGAAGGTGAGGACAGGCCTGGTACTTCCA
GCCACTTGCCTGAGCCCTGGCTTTGGGTTGGAGGGTGGGCTCCAGGATGCCCTGGCACTG
CCTCCTCAGTTCTCAGCTGGCTGCTGA
gccagttgagaggtctagagaggtgagctaagtgttcaagattcaaatggctaaaaagag
gcaaagcttgtttcttaacgtggttctgccagtttcagagcccttgcttgacaacgtcag
gctacactcttttcatggatctcatctccaaggtgttctttagcctgatgtggtcagtgg

Exon  3 +      10746      10782   0    Initial     37    78        Good
atgaaaatgtgtcatgtggcagctcatgccaggcttcaccagcatgcttatggcaaggtt
ttgggccggcctcttcagcttacaggtgagaaaactgaggcctgaggcagtggaacaatt
tactcatgtgtatagtgctcttgagcaaggctagagattcacccttggagggttggggcc
ATGCTGGCTGTGCTTATTTCCACTGGAGAGCAGAACT
gtgagtggcttgtggggaggagtttttctttggtggaatgttcagccttaacctacccat
tatgttctagagatggagaaattgaggctcagagagccccaaggactcaaattacatgtg
atggagccgagacttgctcctagtcctcctggtgcccttgccctcaccacactgggatgg

Exon  4 +      11688      11765   0   Internal     78    58    Marginal
agagacaaaattttgatgaaacgatgttgaggctatcatctaaaacacagcaagggagca
cactccatttttgggggtctgtgtgtatttggacattgtagcctggtgaatccttggtct
tctggatacacaggtagtgattggatgtgttagtgtttgtcttctgttgttcattttcag
ATTCCAGCTAAGAAAGAGTCTTGTCCAAACACTGGAAGAGACAAAGACCACCTGTTGAAA
TACAACGTTGGTGATTTG
gtgtggtccaaagtgtcgggttacccttggtggccttgcatggtttctgcagatccactc
cttcacagctataccaaacttaaaggtattgtgttctttgggttgtttttccaactttct
cttctgcacttaatctttctcatctccaggcttctttcttactctttctaaatagccctg

Exon  5 +      15398      15531   0    Initial    134    55    Marginal
gggactacaggtgcacgccaccacacccagctaatttttgtatttttagtacaaatgggg
tttcaccatgttggccaggatgatcttgatctcttgaccttgtgatccacccaccttggc
ctcccaatgggattacaggcatgagtcactgtgcctagcctccatctcttttgttgcatg
ATGGCTGGTAGCTTTCGTGGCACTGTTACCCCCAAATACGTCAGAACAAGGACAGTTTCC
TTATTGACTCAGCACCAGCCGCATTTCGGGAAACATCACATCAGTAACAAGATCTGTTGC
TGTGCTAAGAGCAG
gtgtagggcgtgtccccagcaggcccctacctgtctttttctgtacttcagggttgagat
gcatactcggcatctggtggttgtgcctctttagcttctgctagtctagaacagcactcc
caatccccaattcctcatgactgctttagctttctcatgatcagacctaggtcagaaagg

Exon  6 +      24343      24509   1   Internal    167   100   Excellent
taagttaattagtttccctctttggcatgtggcatggaagggataagaagtatagaattt
gttttgaggttaacaggctcagacaacaccaagggaaacaactgcaaaatagcagtagat
ttgactagtttcatcccagattctaactttcattctctaacattttattttaaaaactag
GTCAGAAAAAGAGTGCACGCCAGTATCACGTACAGTTCTTTGGTGACGCCCCAGAAAGAG
CTTGGATATTTGAGAAGAGCCTCGTAGCTTTTGAAGGAGAAGGACAGTTTGAAAAATTAT
GCCAGGAAAGTGCCAAGCAGGCACCCACGAAAGCTGAGAAAATTAAG
gtgatagatgacccttcagtctacttttagaccagaaatttaatttttattctttaagtt
aacttatttttgttttgaacttatacttgctcgaaatattgtaatggcttaacaatctct
ttcattgttgacttttgcccaaggatgccatgttacaatatgataaagttcttttagaga

Exon  7 +      25613      26140   0   Terminal    528    76        Good
agtagagatggggttttgccatgttgaccaggctggtcttaaactcctggcctcaagtga
tccatctgccttgacacccataagtgctggaattataggcatgaatcatgtgcctaggaa
aagtagttaacttttatgtttgtgtagtgaaacttacagtgtctcttttttttttcccag
CTATTGAAACCAATTTCAGGGAAATTGAGGGCCCAGTGGGAAATGGGCATTGTTCAAGCA
GAAGAAGCTGCAAGCATGTCAGTGGAGGAGCGGAAAGCCAAGTTCACCTTTCTCTATGTG
GGGGACCAGCTTCATCTCAACCCTCAAGTAGCCAAGGAGGCTGGCATTGCTGCAGAGTCT
TTGGGAGAAATGGCAGAATCCTCAGGAGTCAGTGAAGAAGCTGCTGAAAACCCCAAGTCT
GTGAGAGAAGAGTGCATTCCCATGAAGAGAAGGCGGAGGGCCAAACTGTGTAGCTCTGCA
GAGACCCTGGAGAGTCACCCCGACATAGGGAAGAGTACTCCTCAAAAGACGGCAGAGGCT
GACCCCAGAAGAGGAGTAGGGTCTCCTCCTGGGAGGAAGAAGACCACAGTCTCCATGCCA
CGAAGCAGGAAGGGAGATGCAGCATCCCAGTTTTTGGTCTTCTGTCAAAAACACAGGGAT
GAGGTCAGTACTAAGTTGTGTTTCATGCTAGCAAGTTTCAGAATTTGA
ggaacatcccttcagtgcagaatcatctgtttctcagcattatcaggagactctaacatg
agccttgcatagattttagatctaataaataagtattagggaacagccattctgaccctt
gagggaaaagatactcgacttgcactctggggtcttaaaatatccttcctaatgtggata

Exon  8 +      30816      31013   0    Initial    198    50    Marginal
gctataaaggctataaaactatgtatgttaaaatgaaaatctaggccaggcatggtgact
cacgcctgtaatcccagtactttgggaggctgaagcgggaggattgcttgagccactgca
ccacttcagcctgggtgacagagaccctggctcaaaaaaaaaaaaaaaaaaaaaattctt
ATGTGTCAAGGACACCATCGACACAGTGAAAGGACAAATTCTGTAAAGAGCCGAAACAAT
TCTGAAGGAGAAGGGCAAGTTTCTTGGAGAGCCAGTAAGTGCATGAAGAGATGCTGCTCA
ACTGCGGCCATGCCCAGGAAGCTGTATGTTACGATCCTGGTGGGATGGTCCTTCACAGTC
ATCCTTCACAGTCATCAG
gtgagcagacatcaaactcagaacagccagggattgagaagatgagcaacagtgggactc
ctcatacaatgctggtgaaacatcatttattacacctgttttgagagaaatttggcaaga
tctagtgaaattgaagatgtgcctttttttctcttacagttttactcctagatatttacc

Exon  9 +      36886      36999   0   Internal    114    52    Marginal
ggaggctataagaagccgtctgtggtgactgtcttgggaggaggggtttgggtttggggg
cagaggttacctgtattggctgggcaggtggtaggtccaggtggtaatggtaaccaacca
acattaacctgatggttccttaccactgccaggtggagtgttactgcccccgtttcacag
AGTGGAGGCAGAGACAGTGCCTTCACTTGCCGAAGTCCACAGAACTACCCAGTAGAGGAG
CCAGCATCAGAGCTGGTTGGTGCCGAGCCAGTCAGCAGACTTTCCAAAGGGCTG
gtgagcagtgagggctctgttctgactgctcagctctgctgttgtggcaggaagacagcc
atgggcagcatgggaacaaatgcatggggctgacatccagtaaaactttgtgggcactgt
tgtttgaatttcctgtaatttttgtgtcatgaaatattatgatgtttttcagacattgaa

Exon 10 +      37508      37550   0    Initial     43    43    Marginal
gggttgatcttgggtgggacctaagcaccataggatttcaaacccccaggttattaccag
gtggagcgaagtccccaggatcagacttcggtgtgtctgcggatcatcctagagaccttg
tgaaagtgcagattcctggtaggcaggttggggtggggcccgggagtctgcatttctagc
ATGCTCCGGGTGCTGATGCTGGCAGCCCTGGTGTGGCTGGAGG
gtagggaagcctcgtcttttggctgtgcaaggttgtctccgtgtgctggcctgggctgtg
acagaagccagctcgcactccttggtgtgtgccttcacccctgcccagggcctgtacctg
aaagacgagggtaggtgctgcccagtgaggacactgagctgagcccacctccatgttcag

Exon 11 +      38098      38277   0   Internal    180    96   Excellent
gtcacagcatcagttaagcactacttttctttgaagcttttatggacatagttccacgat
gtgggaataaaaatgcgacacactaagttctaaagggccgtgcatttgatttcatgcaaa
acaaaacccaatgagttttacggatttaacttctcattgcaccttctcccgttcccacag
GTGGTAGCTGAGCACCCAGATGCTTCAGGTGAGGAGATTGAAGAGCTGCTCAGGTCACAG
TGGAGTCTGCTGAGTGAGAAGCAGAGAGCACGCTACAACACCAAGTTTGCCCTGGTGGCC
CCTGTCCAGGCTGAAGAAGACTCTGGTAAACATAGCATTATGCTGATGTCCTCTGCTTGG

gttgatgtgtgtagtgtagcaagctgagctctgatcttggaaccgtagggaagtgtgtcc
actctccctgtttctgacccgtggggtttgggccagcggtccaagtgcgtgtggtcacag
taaaaacagcttctgccatctgcgtttactggcttatgagagctattcaatgtagtgcct

Exon 12 +      45923      46041   0   Internal    119    84        Good
acacatttccaaaggaagaagtttctgccacgaaacttttcagcaacctgtgttcattca
catgaggagattttttttcctttcttttccttttgttgttctttttctttttttttcctt
tttttcttttcttttttttttctttctttttttttttttttttttttttttaaataatag
AGAGACACAATCACTGACAAAACGGCCAGAACAAGCTCTTACAAGGCCATGGAGGCAGCC
TCCTCGCTCAAGAGCCAGGCAGGTAATGTGGTCAGCGCCCTTTCCTTCTTGGCTTCTGG
gtgcccaggctgggctgggtgggtgggctgagagtgtgaaaggggaaggctggggctggt
gaaggggaacagggcaggggaggaatccacaattaagctaggagtgaaaaagaaggaaag
gaggttctcctgtggttgaaaactaaactgttttaatgtgtatgttattttgaagggttt

Exon 13 +      48407      48450   2   Internal     44    74        Good
tctgccatggtccccaggaaggatggggtgtgcctcagttgtttccactcattagaggag
tgtaggccttccagtgcaggaaggtcagggacctaggcaacctgggcggggctcatagag
ctctgcggcttgccactctgaatcctcagcgaccactcctccgagtgggattttctgcag
GGACTCAAACCAACTCAGTGGTGGTCGAGACCTGTTCACGGATG
gtgggactggggctgctttacagtttgatacgtgtagataattaagcattttgtgatgtt
tggacacactggagaaaaggcagtaagaattatttactgaaacatctaggagcttactga
aatatgaaaaggcaaattttatacaaattatttttcctttttcctttctttcttgtccaa

Exon 14 +      58544      58675   0   Internal    132   100   Excellent
gttatattatcacaaaaaccagttgatgatggttccactgtgaaatcactggcggtacag
gaccagtgctgagaaagactggtgggtggtggggtggggcgggacgagcctgcctgcagg
gcatggccacccgctgtgttctgcgactagtgaactgtcatccgcctccttcatctctag
GTCTCGGACAGCCCGGGAGACGAGCCCTCGGAGTCCCCATACGAAAGTGCAGACGAAACA
CAAACTGAAGTATCTGTCTCATCCAAAAAGTCTGAGCGAGGAGTGACTGCCAAAAAGGAG
TATGTGTGCCAG
gtgaggagaaggcagcatccgctatgtccgtgctggtgtctgactggggccccggtacgc
agagcgaatttgtagtgtcttttcccttcccaccagaccccttccccaatctcaccgtca
ctcactcatctctgttttgaaggggtcagactgactctcagtggaatcctgggattgagt

Exon 15 +      60947      61070   0   Internal    124    74        Good
tctccaccccttctttaactttttgttagggattcactcatgtttcgtgtgtaaagagag
caagacagatgttaagcgctgtgtggtaactcagtgtggaaaattttaccatgaggcttg
tgtgaaaaaataccctctgactgtatttgagagccgaggtttccgctgccccctccacag
CTGTGTGAGCTGCCATGCTTCCAACCCTTCAAACCCAAGGCCGTCAAAAGGTACAGGTGC
ACCTGCGCAGCCTTGCTGTGGGTTCAGATGCAGGCCAGACGCAGGCCCATGGGCGCTTGG
GAAG
gtgggctgttgggattgtcaccaaagagcattaattatcttgagtgactaactggacatc
ggctgggttgggttttctttgacaaaggacctgtctcccttttccttctttccatcctaa
atatcaccctaaagatgcttaactataggagaggggcaacctttggaccatttgatagat

Exon 16 +      62633      62812   1   Internal    180   100   Excellent
ttttctcaaacatggttttgaagcacctttgctctgaaagctttttttaaatcaaatacc
tccatttcattttagcattaacttttcaaattcatggaggctgagtaattattagttgct
cttttcactatgactggagtcagtgtttggggtccttagggtgtgtttctttgccttcag
GTAAAATGATGCGGTGTGTCCGCTGCCCCGTTGCCTATCACAGCGGGGATGCTTGTCTGG
CAGCAGGATGCTCAGTGATCGCCTCCAACAGCATCATCTGCACTGCCCACTTCACTGCTC
GGAAGGGGAAGCGACACCACGCCCACGTCAACGTGAGCTGGTGCTTCGTGTGCTCCAAAG

gtgaggggcctgggggtgtctgcggcacacgcctctcacactcccaggagccacatatca
aggcaggctcattccttgtctgcgctgtgttcattgatgttgacagtgttctgtgcgtct
tcacgttaatagtatatcacagtagctctaaattaattgtaatcatttcgcaaacataca

Exon 17 +      63165      63323   1   Internal    159   100   Excellent
aacatacaggaaattatttgtggtgaaaatgacatttgctctcgtgctgatgtacagatc
gctgttttaaaactgatgtttataagttaaggctgtaataagtgtagactgtgaagcact
gaatctgggctgagccatagcagacaggctaagcctggccgcctcgccctcctcttgcag
GGGGGAGCCTTCTGTGCTGTGAGTCCTGCCCAGCGGCCTTCCACCCTGACTGCCTGAACA
TCGAGATGCCTGACGGCAGCTGGTTCTGCAATGACTGCAGGGCTGGGAAGAAGCTGCACT
TCCAGGATATCATTTGGGTGAAACTTGGGAACTACAGGT
gtgagacatagaatcgtatgcttttatgtcttttctgttcacatgtgttcgctttacagt
acttaaagtattgaaattattatcgctgtctctgaggagtctgtgaatcctgtttttaat
atttataatagatggtggccggcagaagtttgccatcccaaaaatgttcccccaaatatt

Exon 18 +      63510      63660   0    Initial    151    75        Good
catagaatcgtatgcttttatgtcttttctgttcacatgtgttcgctttacagtacttaa
agtattgaaattattatcgctgtctctgaggagtctgtgaatcctgtttttaatatttat
aatagatggtggccggcagaagtttgccatcccaaaaatgttcccccaaatattcagaaa
ATGAAGCACGAGATTGGAGAATTCCCTGTGTTTTTCTTTGGGTCTAAAGATTATTACTGG
ACGCATCAGGCGCGAGTGTTCCCGTACATGGAGGGGGACCGGGGCAGCCGCTACCAGGGG
GTCAGAGGGATCGGAAGAGTCTTCAAAAACG
gtacggagatattcagatagagagtgagacagcactctcgtgcattttcttacccctaat
ttctattttttaaaatttgatctttatagaaaatactggactaagcattcaatctgtttt
tttaaattaggaaaatgtttgcagtctggtttatttgttgagcatagaataagatacact

Exon 19 +      64034      64297   1   Internal    264    54    Marginal
acattggtttgtgattaatttcattaaaattctgtaaacctattattcagaaattatttt
taatactaatttacagaaatgttccatggcttgcctttatgtaaaatgcagatctgaagg
aagggtcctgttgtctcgaccttgtgcagcaggctcttgggggctcgctttacctttcag
TGCATGAGGAATCAGGGGTGGTCAAGCAGACAAGGTGCTTGGCCTCTGATTCCCCAGCTG
GGGTGGGAGGCAGGAGCAACGATGTGGCATGGCTGGCTGATGACCCACGTTTGAGGGAGG
CAGGATGGGGATGTGACCCTTCACTGGAGGAACTGGAGGAACTGGTATTTATGATCGGTC
AAGAGAGAATGAGGCCAGTAGAGAAAACCCGAGGTGTGTGCATGTGGCTCGTTCAGGGAG
AAGCACACGCTGTGTTGCAGCCGG
gtcagtgctggctcctgtgtgactgcaggcggggacccgcgtatttaaagcttggttagc
tccatgctgccagaagctttgcaggctgcactgagtggtaggagtgcatggtgggcattc
agagatctcataaagaatgggtaggcattgaaagattttaaaaaattattaagagggcga

Exon 20 +      65405      65508   1   Internal    104    94   Excellent
cacacttggccgcatttaaaaatacctgcccactgacagttgttcatagactctagtttt
atgggaaccagaaactatacttaacattgaaagtttagagtgaactataaaaatatggag
cttgaaaggtagttacctgtatttactaaaatctttactcctatttcattgactttttag
CACTGCAAGAAGCTGAAGCTCGTTTTCGTGAAATTAAGCTTCAGAGGGAAGCCCGAGAAA
CACAGGAGAGCGAGCGCAAGCCCCCACCATACAAGCACATCAAG
gtggcgtgtgggagctgcgtgcacgcgtgtggagggagtcttccccgagggccgtgagag
gttcttaggcacacccaggctatggctggggagaggactgtcaccagccaggatctgtgg
tgcctggcatggatggccacacaagagaccatgagcaaatggcatggggggatctgcatg

Exon 21 +      66943      67212   0   Internal    270   100   Excellent
gcagaggagagctcctctgggatctggggagggctgttctgagtagtgtgtcctagccag
gactctgaagctttctaaaaggccacctggaggctgggtaaggagaggcagtggtgggtg
tgcaagggtattcggaaggctctcatgtgtggaccaagacagcttactccttccctgcag
GTGAATAAGCCTTACGGGAAAGTCCAGATCTACACAGCGGATATTTCAGAAATCCCTAAG
TGCAACTGCAAGCCCACAGATGAGAATCCTTGTGGCTTTGATTCGGAGTGTCTGAACAGG
ATGCTGATGTTTGAGTGCCACCCGCAGGTGTGTCCCGCGGGCGAGTTCTGCCAGAACCAG
TGCTTCACCAAGCGCCAGTACCCAGAGACCAAGATCATCAAGACAGATGGCAAAGGGTGG
GGCCTGGTCGCCAAGAGGGACATCAGAAAG
gtatgtgtcgttatcccctcccctgcttttgagaaattacggttcactgggtaattaggc
ctaggtttgcttgtggtggttttgtagtcatgtgagaatggtattttttggaaaaaaaat
tttttttgtttttgttttgagacagggtctcactctgtcatctaggctggagggcagtgg

Exon 22 +      68507      68654   0   Internal    148   100   Excellent
atacagatatgtctgagatcctttgaatttaatttatggagactttgtacacgccctcca
cggaggtatgctgatgtgtgtggtgcccgttctaagtgatcatgatggggagtcttgagc
cccgacactgaggattggtcagcacgctttttgtcatggccacatgcttgtgatttccag
GGAGAATTTGTTAACGAGTACGTTGGGGAGCTGATCGACGAGGAGGAGTGCATGGCGAGA
ATCAAGCACGCACACGAGAACGACATCACCCACTTCTACATGCTCACTATAGACAAGGTA
ATGCGGAACTCCACTGTGAGCTTCTGCA
gtgtgctggacctggagccctgatggtcacctgtagaactggactttgccctgtggcagc
gccagcatttgtctccttagctgcttattttcaaacatctgcacattttcttctgaggtg
cagcgtgtctttcagctgcgccggagggctagagctaaccacctctcagcacccaggcac

Exon 23 +      69211      69326   1   Internal    116    70        Good
gtttttgcttggttgttgcttgtatgcagcccatatttctaaccattttggaacctaggt
gctagagggatcaatgttctgaggaaaaggaggataggaagatttgtgtaaaagtgggca
tggataaaagacagtacatctggagtgctcagctctgggcctgatgcccaatcctgacag
GTGTTGCCGGGCCCTTCCAGGGCGGCTCCTTCAATGGCCACAGCCCTGTGGGGGTGCGTG
TCATCCCTTCCCTCACACGGCAGGCTTTTGGCTTCTGGATGACTTCAGCTGGGGAA
gtgtggcctccttagtgcctgagtggtctttgaaaggaagggagatagaatacatgtttc
tgccttttgttgcccttaagctcatcatctagcaggaaagtctggctatttttaaaagag
tagattaatagtagtgcttgaaaaccagatagaaaatgatcaccgataaaaaaatgttga

Exon 24 +      69692      69782   0   Internal     91    57    Marginal
tcatggaagacagatgtgatgagacctagagagaaagggctgctatggaaataagaatgg
ttccaggaaccttgtcaggtggcccctggggaagctatatcccctacccctgcagtagtg
gggcagcagtggccagtggagcctgctccgggggagcactgggctctgtgtcaatcacag
GTCGTGGGGCTTACACCTTTCAAAGAAGTCAGTGTCATGAAGGACAAAAAGAATCCTGGG
TTAAAAGAGACTAAAGAAGTACCCAGAGGAG
gtgtgtgcttcttgatcagagcctgaatctgggatgaggagctataaagtatgcttttgg
gggcagtgggaaaaattttaatttggacaggaggctgttcttcatgctaaatttcatagg
tatggaaagtgttgtggctgcgcaagagaatgacttgtgatgtgtttagggtcagatgtc

Exon 25 +      71763      72002   0    Initial    240    52    Marginal
cctgaggtaacaagactacatttaaaggagaatgtgaactaagtgtattagaaatggtta
aagccatgaatagagctttagacgccacaagaaaagaatgagatatggagggtaaatcag
acaaatacgaacaaacagcagcggaggttaaaatagagtcattgagaggatcctgggata
ATGGCAGAGCAGGAAGCTGTGTCCCCACCTAGACCACAGTTGCACCAGAAGGACCTGTCT
GATGTAACCATTTTGGAACTCTGGAAGCTACTGAAGGCTTGCAACTTCCAGGGGAGGCTT
GGATGGCAAATTGGGGTTAATTTTGGTTTCAGCTCTTGGCACAGCAGCGGCTACCCATGC
CCCACAGACAGCCATGCACATGTTCTTGGAGCACCTCGCACACAGCTTGAGGGGTTCAGG

gtgagcaagaaggatccttttctccaaatagtgggtatctgtgctcaggatccctgattg
ctgcttctgatcacagaggtgcagacaaagaggtgcgctgcgctgccgttgttatcacac
ctccctcagtcgttacaagcccctccccctccagctgaagtatcttcaagagtatttaaa

Exon 26 +      72627      72764   0     Single    138    73        Good
aaacctagggcaaggggaggaagaatctaatttctagagttaccacattattagacttaa
catgtccagtgttcagcaaaaaaaaaaaaaaaaaaaaaaaagcctacaaagagacaggaa
aatatggccatttaaagggaaaacaaaatcagcagaaactatccctaaaagaaaggccag
ATGATAGATCTACTAGACAGAGACTCTAAAACATCTGCCTTAAAGATGCTGAGAAAACTA
AAGGAAAACCTGCAGAAAGTCAAGAAAATCATGCATGAACAAAATGGCAGTATCAATGAA
GAGATAGAAAACCTATAA
agagaaacaaacaaaaaaaggaattgttgagcctgagaaacagaaaagaagattgaagaa
aagtgaacggatcataaggggtatgtgggctaccaccaagcagaccaatatatctattgt
gggagtcccagatggtgaagagagaaagaggcagagacaactttgaaaaaataatggctg

Exon 27 +      73409      73670   0    Initial    262    47    Marginal
tttgcacatggcggcaggagagagaagtgtgtgagagcccaggaaaaactaccatttata
aaaccatcagatcttgagagaactcactcactgtcatgagatggcatggaggaaaccctc
ccataatccagtcacttcccaccaggttcctcccttaacacctgaggattacaattcaag
ATGCGATTTGGGTGGGGACACAAAGCTAAATCATATCACAAGGGATTCTCAATGAGATTA
TCAGCAAATTTCTCATCAGGAATTTTGAAGGCCTACAGGCAGTGGGCCAATGCTAAAAGA
AGAAAAAAAAATGTTAACCAAGACTTGTATGCAGTAAAACTGTCTTTCAAAGATAAGGGT
GAAATTAAGACATTCCCAGATAAACAAAAGCTGAAGAAGTTTTTTAGCACTAGACCTGCC
TTGCAAGTAATGGTCAAGAGAG
gtaatggagagaagtcttgtaggttgaaatgaaaggataccatacagtcactacaagttg
tatgaagaagaaagatctcaaagtaaatacatggtcagctataaaagtttgtattgttgt
aaccgtggtttataactccatttgtttgtttgttgtctgcatgattgaagagatagggct

Exon 28 +      75806      75894   2   Internal     89    73        Good
tcagtataatttagctgaatgaaataatgagatattttaggaagaagaacattgaatgtc
agaagttaaatgtgagatccaagaagtaacagtgaacagacaagtttgtgggtatgtgga
tatgtcttaaataagtcaggttgtgtcaaattatgatggatgatgatgactgcgaggcag
GAAGGAAGATGAAAAGGAGGAGGCATTGAACACTAATGGTCACAGGGAGCACCGGGAGCG
TGGTGACGCCAGGGTGAGCTGCTTGTTCT
gtgagggtggagggaagagatttattaaccttagactttgttaaagtatacatgtgacgt
ctacatgggaaactgctaaatgaatagaagtggaaggtgtaacttccacaccattaaagg
gtaaaaaggagaatgaagaaaagtcaatttagtagaacctgcgggaggaagatgggggaa

Exon 29 +      80880      80983   1   Internal    104    82        Good
gacatggcgggcaacccacagatgaaaactggcccgataagaaggaagtggcactgggcc
ccgctggtaatggtaggaatgtaggttagacacggtgctgccaggcgtcagaggctgggt
tgtcctgttggcattggtggcatgtcccatgtgcatgccccgtgctgtcctcgtccccag
GGCCCTGCAGAAGTGGTGTGCATGCCAACGTGCACATCAGCACCGCGGCTCAGCGCGTCA
TGACAAAGCATCTGCAGAGGGCAGATGAGCACCCCCACTTCTGT
gttgaagagtggcactctgggttgattagtgcattttattattgtgaaaagcatcttgca
gagaaccacattctggtaccatttctggttttaaagggtggcctgtgtgggtatgtagaa
aggacacggggccagcggtcccagacaggggcaccctgggagattgcaccagggctgggt

Exon 30 +      82335      82457   0   Internal    123    76        Good
tgtgagcaagagaaacaggactggtttgggggtgtcctgtctcagtggacacaggacacc
acggttttcagtacaacaaggaacacaacttgttcaatgtgctttatgatggtgaaaatt
ccctttaaaaataacatgcgattgctaacacttgaccgaatatatcacttgaccttacag
GACCGTATAATAGACGCTGGCCCCAAAGGAAACTACTCTCGATTTATGAATCACAGCTGC
CAGCCCAACTGTGAGACCCTCAAGTGGACAGTGAATGGGGACACTCGTGTGGGCCTGTTT
GCC
gtctgtgacattcctgcaggtacaagctctggggaccctgcatggggctcctggctatgg
gggcagagtggccatcgctgagggctgcgtggggctggactggaaaggctctgggggagg
tgggtgctgatgtggagtctcttttggtttgaatatctcttttaccaagcaaaattgaaa

Exon 31 +      82477      82576   0   Internal    100    50    Marginal
tgctaacacttgaccgaatatatcacttgaccttacaggaccgtataatagacgctggcc
ccaaaggaaactactctcgatttatgaatcacagctgccagcccaactgtgagaccctca
agtggacagtgaatggggacactcgtgtgggcctgtttgccgtctgtgacattcctgcag
GTACAAGCTCTGGGGACCCTGCATGGGGCTCCTGGCTATGGGGGCAGAGTGGCCATCGCT
GAGGGCTGCGTGGGGCTGGACTGGAAAGGCTCTGGGGGAG
gtgggtgctgatgtggagtctcttttggtttgaatatctcttttaccaagcaaaattgaa
aggccatgggtcaagccagtacagatacaaaaataataagagtatttttgttgacctaat
acacgccccttagcttttgaagagaaaggcaggtgtttccaatttggtgtctgtctcctc

Exon 32 +      82766      82872   1   Internal    107   100   Excellent
gatgtggagtctcttttggtttgaatatctcttttaccaagcaaaattgaaaggccatgg
gtcaagccagtacagatacaaaaataataagagtatttttgttgacctaatacacgcccc
ttagcttttgaagagaaaggcaggtgtttccaatttggtgtctgtctcctcttctcccag
GGACGGAGCTGACTTTTAACTACAACCTCGATTGTCTGGGCAATGAAAAAACGGTCTGCC
GGTGTGGAGCCTCCAATTGCAGTGGATTCCTCGGGGATAGACCAAAG
gtaaggctgtggcgccctccttccccccaggctctgtgttggcattttgcactcctggag
acctgtgtcccccgtgaacagcggcttcctccaggctggcttgttgccgggacaggtggg
agcaagttccctgctgtgggctggggaggatggctctcaacaaaggccagtggttaagag

Exon 33 +      83947      84155   0   Internal    209   100   Excellent
tgagtcgagtgagtctaaggatgtctggggagcacgaggaggacactcctctcctctcct
cttagtgttgggcacctgcagagatctctgaagttcctggagtgtagctcgctcttctgc
cctatttgcttcagcctgtgtaattctttccggtgatctgtgcttaattcttgactctag
ACCTCGACGACCCTTTCATCAGAGGAAAAGGGCAAAAAGACCAAGAAGAAAACGAGGCGG
CGCAGAGCAAAAGGGGAAGGGAAGAGGCAGTCAGAGGACGAGTGCTTCCGCTGCGGTGAT
GGCGGGCAGCTGGTGCTGTGTGACCGCAAGTTCTGCACCAAGGCCTACCACCTGTCCTGC
CTGGGCCTTGGCAAGCGGCCCTTCGGTGG
gtgtgcagcctcgcggtggcttgcagctgtgtctgtgtggcaggctcctgatggcggctg
ctgccgctcttcctgctgaccgggcctcatctgggtgcaggcacatcaggcgctcatgca
gcgaaggccctgatccagggtggcagagcctttctttgttccaccagccgcacattctag

Exon 34 +      86801      86904   2   Internal    104    53    Marginal
ctcagcgttaccgccacacttgaatttctccgaatgtcaaggttccctcccactctattt
ttttaggttaaagttaattggcatatggaatgttttaatctcctctgaaatgtgtagcgt
aggcttttcccaagggtcgctagaaactcgtcttcgcgttgccccctttctggctctcag
CGCCGTCGCCACTCGGGAGAGGCTGGGTGAGGCCCGTGTGAGGACTGACCCTGGATTCCT
CGAAACTGCCATTGTGATCATTACTCTGCTCTTTGGAAATGGCT
gtatcatttttttgtactaatgtgaattgttcctcagaaacgcttcttttccatcctagt
gagaagctggccctgcaggtggtggcagcaatggtgttgtaagatttcctcccgtagttt
tttctcctcatggatttgaatgaaatgccaataacacgtccactttcaacgtgtagttta

Exon 35 +      86964      87006   2   Terminal     43    76        Good
ccctttctggctctcagcgccgtcgccactcgggagaggctgggtgaggcccgtgtgagg
actgaccctggattcctcgaaactgccattgtgatcattactctgctctttggaaatggc
tgtatcatttttttgtactaatgtgaattgttcctcagaaacgcttcttttccatcctag
TGAGAAGCTGGCCCTGCAGGTGGTGGCAGCAATGGTGTTGTAA
gatttcctcccgtagttttttctcctcatggatttgaatgaaatgccaataacacgtcca
ctttcaacgtgtagtttacgcggagcactttcgaggcctggccgggttgggcctacttct
cacctgggcctatcttctgaactcgctaggttcttatcaacatttgggggataactttgt

--------------------------------------------------------------------------------