--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16950 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1815       1923   0    Initial    109    86        Good
tttgacatcatttttgcagatgctttttttccttgtggtgagctgctggctgcgctactt
aacataccgtttgtgtacagtctctgcttcactcctggctacacaattgaaaggcacagt
ggaggactgattttccctccttcctacatacctgttgttatgtcaaaattaagtgatcaa
ATGACTTTCATGGAGAGGGTAAAAAACATGATCTATGTGCTTTATTTTGACTTTTGGTTC
CAAATGTGTGATATGAAGAAGTGGGATCAGTTTTACAGTGAAGTTTTAG
gtaagaatttgtttaatcgggaacttgaagatctaacttatttgtgtctttgaagcagag
cttatataaagccataaagtcagggaagtggagtttttggtaagtgaatttatgaaatga
aaatacaagatgatctatcaatctcacaaacattatagaaaagcttaaattataaggtct

Exon  2 +       2384       2533   0   Terminal    150    46    Marginal
ctatataatgttttagatcttaaaaacagtgaaatccatcaagtaacatcttactgaatg
catagatttagaatgagtaattacacatttttctacaactatctatataactgcagaaag
ttttccttgtaaacctcagttttcttttttaggtattaaaagatattcccatgtttccag
AAGGTTTCCTTCACAGTAGAGAGAGATAATGTCCACATCTCAGATGCAAAAGTTAATCAG
GGTAATTTGAAGTTTCTAATGTTTCTATACTCCTTCACTAAAGAATTGGAATTCATTCAT
TTAAAGTCCAATTATCTTGTTGAAGTGTGA
aggttgttatatctatatagtttatttgaaactatgtctctttatttaaaaatatgagac
agattaaggttgagtacagatctctatttcaataatttctcaaaaatttctagctataat
ttacaaatatatttacttaaatgataatattattaagatcttagctcaaatccaaatgag

Exon  3 +       7457       7585   0    Initial    129   100   Excellent
aactacctcaaacatcttcttgtaaagaacctgagtgattgagtcagttaaaaaatatta
tttactccaataattcctcaaaatacttgattttctctctttaatatttggtaccaattc
tttagtagtgcctgctgtggtgatactcttttgtgattaaacaattttttttcacaggaa
ATGGAGGAATTTGTACAGAGCTCTGGTGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCA
GTGATAAGTAACATGACAGCAGAAAGGGCCAACGTAATTGCAACAGCCCTTGCCAAGATC
CCACAAAAG
gtaagataaagtgccttactggtgtggaaaactactgaaagaggctgttaaagtttgaga
tctacacagaaagaatattaaggctagactgaactctttacagccaaatacagtcttaaa
tatcttgtgtagcttccaccgacacaagtcatagttgtgcctcagacttagtggttacat

Exon  4 +      10367      10454   0   Internal     88   100   Excellent
atatatctaaatcattataaaagttaagaaaataaaatgtgagtattgtttttacatcaa
tctctgagtagatttatttactaacatcccttgatctcattcctaccctttttacagttc
taacattctataatttttgagttccactcatggaataagatattctctttactgtaacag
GTTCTGTGGAGATTTGATGGGAATAAACCAGATGCCTTAGGTCTCAATACTCGGCTGTAT
AAGTGGATACCCCAGAATGACCTTCTAG
gtaacactctggtgaacaaatactggatatattagtaactgcacattagaatgttaatag
tttatcttgaaacatgcttattgaatatttattataggaaaacaaaaagaacttctttgt
atttattttccagtcctaggggaaaagaatatggtagaattgctggcattttatgatatt

Exon  5 +      11294      11513   1   Internal    220    99   Excellent
caccacggagacttcaattacatctcctaaacaagtacgtgtttattcctctgaagtctg
aaaagtaatggcaaattagtttaatgtgttatctagaaaacactgtcactttcagagcat
ttcattgtgtatcgcattttattcctatgaataattttgctaaaattcatccaatcctag
GTCTTCCAAAAACCAGAGCTTTTATAACTCATGGTGGAGCCAATGGCATCTATGAGGCAA
TCTACCATGGGATCCCTATGGTAGGCATTCCATTGTTTTGGGATCAACCTGATAACATTG
CTCACATGAAGGCCAAGGGAGCAGCTGTTAGACTGGACTTCCACACAATGTCGAGTACAG
ACCTGCTGAATGCACTGAAGACAGTAATTAATGATCCTTC
gtgagtagaacagtatttttcactaggtggtatttgtagatagcttctcttttcaatagt
gagcatgagtttcatcctttttataagagagtaatcttgaaagaatttaaatgatttaac
caatctgaaatctgctttgttttttatctgttatttaaaaattgtgcttgaatcccatac

Exon  6 +      15232      15455   2   Internal    224    94   Excellent
aaaagtccaatttaaaagcccaactatctatgatgactcaaattaaaatacacaaattct
ctgtcaattctttcaaatttactttgaattatttgacactttaaaagcctttcatagact
tgatacatacaggccagttaacttactttcagtgttggtatctttatttttatccttcag
ATATAAAGAGAATGTTATGAAATTATCAATAATTCAACATGATCAACCAGTAAAGCCCCT
GCATCGAGCAGTCTTCTGGATTGAATTTGTGATGTGCCACAAAGGAGCCAAACACCTTCG
AGTTGCAGCCCGTGACCTCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTTTCT
GCTGGCCTGTGTGGCAACTGTGATATTTGTCGTCACAAAGTTTT
gtctgttttgtttctggaagtttgctagaaaagggaagaagggaaaaagagattagttat
gtctgacatttgaagctggaaaaccagatagatgggttgacatcagtttattccagcaag
aaagaaaagattgttatgcaagatttctttcttcctgtgacaaaaaaaaaaacttttcaa

--------------------------------------------------------------------------------