--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (56578 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1646       2386   0    Initial    741    94   Excellent
agttagcaacggtatcgctagcaactgagccgacccctgcagccagaggtttgcagtggg
tagtgtgtattccagaaagggccctgacatgtgaaaggaaggaatgtgccctaatattct
acagttgttttatcgttgctactgattaggtccatggagggaagcccatccctgagacgc
ATGACAGTGATGCGGGAGAAGGGCCGGCGCCAGGCTGTCAGGGGCCCGGCCTTCATGTTC
AATGACCGCGGCACCAGCCTCACCGCCGAGGAGGAGCGCTTCCTCGACGCCGCCGAGTAC
GGCAACATCCCAGTGGTGCGCAAGATGCTGGAGGAGTCCAAGACGCTGAACGTCAACTGC
GTGGACTACATGGGCCAGAACGCGCTGCAGCTGGCTGTGGGCAACGAGCACCTGGAGGTG
ACCGAGCTGCTGCTCAAGAAGGAGAACCTGGCGCGCATTGGCGACGCCCTGCTGCTCGCC
ATCAGCAAGGGCTACGTGCGCATCGTAGAGGCCATCCTCAACCACCCTGGCTTCGCGGCC
AGCAAGCGTCTCACTCTGAGCCCCTGTGAGCAGGAGCTGCAGGACGACGACTTCTACGCT
TACGACGAGGACGGCACGCGCTTCTCGCCGGACATCACCCCCATCATCCTGGCGGCGCAC
TGCCAGAAATACGAAGTGGTGCACATGCTGCTGATGAAGGGTGCCAGGATCGAGCGGCCG
CACGACTATTTCTGCAAGTGCGGGGACTGCATGGAGAAGCAGAGGCACGACTCCTTCAGC
CACTCACGCTCGAGGATCAATGCCTACAAGGGGCTGGCCAGCCCGGCTTACCTCTCATTG
TCCAGCGAGGACCCGGTGCTTACGGCCCTAGAGCTCAGCAACGAGCTGGCCAAGCTGGCC
AACATAGAGAAGGAGTTCAAG
gtaagctttgcgctctaccccggctgctctgtgtgctcacccaacttccccgctgctgcc
tggcctgctctgccaccgttcgctccacattcggttttgcccagtgaatgtgaaatcacg
agggactgagaacgtcattcagacctcatctaatgttttctttctccctctcaatgatgg

Exon  2 +       3829       3886   0   Internal     58    70        Good
atttttctgatgtaaaagctacacacatttattgtaagcattttccaaaaaagggaaaat
acaaagaagaaagtaagtcttaccttatatctaacccctttgaagagattcattatgtgg
tatttgaaaagatttatttacttggacccaaaatgtttttttttttttttttttttttag
ATCTCAGAGCAAGTTGAAAACTCCAAATTCCGTTTAGAGACAGTAGAAAAGCATTTAG
gtaaagcacttgtaaatatcactttgttgttttgaaacagtaattaaaacataattctaa
acatatttatttgccactatttcaaatgccacacaaatcttgtttttacacatttttctt
gatatatactgaaagtctgcaagagattctataaaagggaatattttctaaggtcgtgtt

Exon  3 +       7278       7569   2   Terminal    292    54    Marginal
atgatttttggaagcccagtaattctgctgagccaaatattacttagtaatatggacaca
tacaatgtctcaggacatgttacaatgggaaattctgttttcctcaagcatttcacatta
gattattatctggttacctttcctaataggctagaattttagtgaaagtcataaaagtag
AACTGGAGTCTCCAAAAATGAGATACTTTCTCAGGAGATGGTCATTGACACCTTCATTAG
AACAAATGGACTAGAAATAAAGCTCCATTCAGAAGGCAACAAGGAATGCTACCAGCTGAC
TTCCTTATGGCAGTCCATGGCAGTGTATAAATATGCAAATGAAATTAAAGATTCACGGAT
TATTTTTAGCAATGTGTTAGTTCCAGTGGCCTGGAAATTTTTCTCTCAGGTACTGAATTC
TGTAACCCTTGAGAATTCAGTTACATACAGTGATATATTTCTCTTCTTCTAG
ttctgcagggcacagtaatatgcccttcagacaaacaaacaaacaaaaaaccctctgtat
acaggtgggtatccatctacctctctacattcgctataaaccagttattctcaaacttaa
catgtatcagaatcatctgaagggtgtgtgaaaacacacagagattgctgggcccttcct

Exon  4 +       9451       9623   0   Internal    173   100   Excellent
tggctaaagggttgggtgggtgcaaatccagcctgtattcagctcaacaagccttgcatc
caggtgggctgcagctttctacccccaaaagaagggatacctttttctaattcacccaaa
tactttccactgaataaaagcaaattatttgtgttaaaacactaaacctcttgttcttag
AATGACTATCGGAAGCTCTCCATGCAATGCAAAGACTTTGTAGTGGGTGTGCTGGATCTC
TGCCGAGACTCAGAAGAGGTAGAAGCCATTCTGAATGGAGATCTGGAATCAGCAGAGCCT
CTGGAGGTACACAGGCACAAAGCTTCATTAAGTCGTGTCAAACTTGCCATTAA
gtatgaagtcaaaaaggtgagtgggcctactttcatctagtgccatattagaataaacat
gtgatacaaactatgccataatcctaggaaaattattaaaataataagactagacgctag
taggctgggcaacataatgagactgtgtctgtacaaaaaagaaacaaaattagctgggca

Exon  5 +      16398      16504   2   Internal    107    63    Marginal
caaatttaaaaattagtccaaggaggaggagtaggaaagggagatatgctataacattaa
tatttctgtcctcaagagtttaaaacctaagaacgactagtgccttagtccgtttgtgtt
gttacaatagaatgcctgagatggagagacttataagaacaaaactttcttgtctcatag
TTCTGGAGGCTGGGAAGTCCAAGATCAAGGCACCAGCAGGTTTGGTAGTCTGGTGAGGGC
TGCATCCTCTAGAGGGGAGGAACACTACGTCCTCACATGGCAGAAGA
gtagaagagcaagctagctgaatgctgcatgaagtcttttttataggcgtcttaatacca
ttaacaagggagcagccctcatggcctaatcacctcttgaaggccccacctgttaactct
accacattgacagcacctgaatgttggaggagacacattcaaacgatagctaccagacac

Exon  6 +      17245      17347   1   Internal    103    75        Good
ctattcaaagcttactgtgtaccctagaacaatgacctcttatcacttaattcaactctg
atgcttccatttttatcttcttgtaccaatacacttgcccaatatactgcctggatcata
ggaggggcttaagacattttgatgagtgaataaatgaatgaatgaatgaaggacatttag
GGACCATAGAGGGAGAGGTGAAGCAGGAAGGAAATGATCTAAATATAGTACAGGAGCAGA
AGTGGAAGTTTGGAGAAGTTCTCAACAAGAATCCTAGAAAGTT
gtcacatatacccaggaagccttcaactttgatattcgtgagttcaaataatgattgcat
tggtctatgaaatgctgttttcaaaacttagaaccttggaaaagtgacaaaatcctgggt
ttggagagaagatctaatacatccttagcaactagcagctactgaaaatcaggacctggg

Exon  7 +      19713      19908   0   Internal    196    98   Excellent
aattttgaaaaatggagggaaagctaagaagaatattaccagaaccttccagtaccaata
tgctagaaaaaatatgctttaatatctttaggatgcatgtgtatttaatagttgagctat
tgacaatggtatggtaacttacctttctctccccttctcaaactctctctctcccaatag
TTTGTGGCTCATCCCAACTGCCAGCAGCAGCTCTTGACGATCTGGTATGAGAACCTCTCA
GGCCTAAGGGAGCAGACCATAGCTATCAAGTGTCTCGTTGTGCTGGTCGTGGCCCTGGGC
CTTCCATTCCTGGCCATTGGCTACTGGATCGCACCTTGCAGCAGGGTACTTGCTTTCTAC
ATCTATTTCCTCTGTG
gtggtgtactgtgtctctttgggataaaaaaataaaaagcttcatgcttaagaatcttat
cagttttaccctgaatgttaattgattcaagaacacagattctcctttttaattactgga
tcaattcaaataagggatgaaaaaggatttggtaccagtgggatataccacatttgcagg

Exon  8 +      21377      21585   1   Terminal    209    50    Marginal
gcagagaagggaaacatggaagttgagccattcccagagcccatgtttagagctgccgta
taccacctatcttatggaaaaaggcaacatagcaagaattttccatgtatgtcccatttt
tgagattggcattctgctttcttttcatgttatttaaagttttaaaagattgacctttag
GAGAAACAGACTTGGTAATTCCCAAGAAATTTCTATGTGCTACGGATAAGCTACCCCCAA
ACGTGCCCTTTTTGCAGCTGTGTAACAACAAGGTGATGTGTAAATGTGTTGTTTATTCTT
CTGTGTCTAACATGGAAAATGTGACATTCGTCTGTGTGCATTCATGTTCAATCCCAAAAA
TCCCTGACATCTCTTTCATCATTTATTGA
catcccattaaggttctagacctacaaaaacatttgtttggagttaacagtcccttaaat
gtgaacctcagtactttataaggtcacagacagagttaaaaagcagggtctgagagtgta
gaaaagagaacatacttgataaatctaccaaatgtacctaattcttggactgtgggggcc

Exon  9 +      22591      22780   0    Initial    190    94   Excellent
aaagaatatttttcataatataaagctttttggaaacagaagcagaattttgagtgttct
cctttcatctattttttttaatcctatgttgtaatctccacaagtgaaagccagattttc
tgaagcaaacttttcctctttggtttgttacagctggggaaaattctgcgaagccctttt
ATGAAGTTTGTAGCACATGCAGCTTCTTTCATCATCTTCCTGGGTCTGCTTGTGTTCAAT
GCCTCAGACAGGTTCGAAGGCATCACCACGCTGCCCAATATCACAGTTACTGACTATCCC
AAACAGATCTTCAGGGTGAAAACCACCCAGTTTACATGGACTGAAATGCTAATTATGGTC
TGGGTTCTTG
gtaagtcttttattttaaatatcctaatttctaccaaaaggtaattatagaaataattgt
cattttctattgaaaaaaaatgttattatatcttatatggtgacaacatcactgttgcaa
gataagctaaatagcaaaataaccaaataattttctagctagataatgccaaaaggtgtc

Exon 10 +      24270      24503   1   Internal    234    78        Good
tcttccatttaactctgcacagggcctcagtgaccatacagtcagtcagtcaatgctttg
tgatgcctagtactgtgcttgacgtgtagggtagagatgtgacctgatggtggacacaat
aatggcttctcagtctggcctgtaaaatctgacctgcaccctctgtatttgttgtgacag
GAATGATGTGGTCTGAATGTAAAGAGCTCTGGCTGGAAGGACCTAGGGAATACATTTTGC
AGTTGTGGAATGTGCTTGACTTTGGGATGCTGTCCATCTTCATTGCTGCTTTCACAGCCA
GATTCCTAGCTTTCCTTCAGGCAACGAAGGCACAACAGTATGTGGACAGTTACGTCCAAG
AGAGTGACCTCAGTGAAGTGACACTCCCACCAGAGATACAGTATTTCACTTATG
gtaagttgttagcttcagggtccccttgtgttttgggaaaggtattggaaccacattttg
gaaggaaatgccaattggagtatgtttagtatgagaggtgtattgaatatttatggacag
tggagaaagcatgaactttggaacctacaaaactggattcatttcaaggctctgaccccc

Exon 11 +      27090      27300   1   Internal    211    93   Excellent
gaatttacgtttctggtttaagatgaaaatagtccctggacagttaattaaatctagatt
agtttcaactgagatggtaaccacctacctacaagatagatcctatttaaggtatttgct
ttgcgtagttggcaatgaatagaaagctccatttttaatctctttctctcttttttctag
CTAGAGATAAATGGCTCCCTTCTGACCCTCAGATTATATCTGAAGGCCTTTATGCCATAG
CTGTTGTGCTCAGCTTCTCTCGGATTGCGTACATCCTCCCTGCAAATGAGAGCTTTGGCC
CCCTGCAGATCTCTCTTGGAAGGACTGTAAAGGACATATTCAAGTTCATGGTCCTCTTTA
TTATGGTGTTTTTTGCCTTTATGATTGGCAT
gttcatactttattcttactaccttggggctaaagttaatgctgcttttaccacgtaagt
aaaatatcttattatacaggtatgataaagagaaattctaaccaatctagaggaagcaaa
ggaaaaatttctctgattgtaataaagatgtttttaagcacagaaaataatccatcaaaa

Exon 12 +      30140      30335   2   Internal    196    81        Good
gaaaacctgaaagaataatttttctatgaaatgtcataacaaagtaatcctgctcttgga
gtatattatggtggcattttacatctgtacagtagttaaaccctaacttgttttttactt
ttcactcttagatattgaaaactgttaacttacttactttgtatcttattttttcaacag
TGTAGAAGAAAGTTTCAAGACTTTATTTTGGTCAATATTTGGGTTGTCTGAAGTGACTTC
CGTTGTGCTCAAATATGATCACAAATTCATAGAAAATATTGGATACGTTCTTTATGGAAT
ATACAATGTAACTATGGTGGTCGTTTTACTCAACATGCTAATTGCTATGATTAATAGCTC
ATATCAAGAAATTGAG
gtaaatcggttttctatccatagtatctatccttgtcatcctattctgatagtacacatc
tgcttctgtaccctgtggctgagctccagctcatgtaacaaagaggcttatatccacaca
gagcctgagcctttccctgtgttttctacctggatagatagctctacacattctgctgtc

Exon 13 +      31596      31805   0   Internal    210    82        Good
agtatcttatatttgaaaaatgagaatattgtgtaggtctatagaatatatgtagataaa
tgtgtataagttacctatttcaaaaacgtaacttagattcattgtaaaaaacctattagc
aacagtcactagaatatttagcatttaaaattagtttttttttctatttttgtgacacag
GATGACAGTGATGTAGAATGGAAGTTTGCTCGTTCAAAACTTTGGTTATCCTATTTTGAT
GATGGAAAAACATTACCTCCACCTTTCAGTCTAGTTCCTAGTCCAAAATCATTTGTTTAT
TTCATCATGCGAATTGTTAACTTTCCCAAATGCAGAAGGAGAAGGCTTCAGAAGGATATA
GAAATGGGAATGGGTAACTCAAAGTCCAGG
gtaggtatcgaaaacttaccaagaccttaaaataaatgttctgtcttttttttcttgtct
tctgatgtttgttcaataatttttatgtgtgaacttagaagatgttaaaagtaactgtct
agtccacagtctttcacagactaatactaaatattttcatgatgtttcaagaagtcactg

Exon 14 +      42714      42882   0    Initial    169    67    Marginal
ccgtgttttatttacaccattttcccccttcctctcccagctcctgcttgttaaattatt
agaactgtgtttgttgggggaagaagaataattttcttaatccctttaggttcagtacct
gggggctatgaattaaactgacaactgactgataaacaggaggggaaaaaaggattattt
ATGCATGCAGTGCACATACCTGTAGAAAAACTCAGTGATGAGTGGCTCAAAGGAGTAGTT
GGCATTTGGGGCTTATATACCAACTTAACAAGGGACAAGAAGTTTGTGGAGAAGGGATAT
GACAAAGGAAAAAGTGTTTGGGTTGCTAAAGGTAGTAAATTGTTGGAAG
gtaaatatgtgggagaaactgatagaagatacaggttattttagtaaggtttgcttgtgc
agaaccaccttggtgctgactttctgtccccagtggtaatgattgtttttcctcctgcta
atctgggagggggagaggaagaagatcttcacaaagggaaatgtatgtcctgtttttagg

Exon 15 +      52228      52303   0   Internal     76    68    Marginal
tcagtagaaggcattaagagagttaagttctgaaacctgcgtaatttttctatacatagt
tataaaatttttttctcccctgagttgtttgctttacaggtatgtaagcctctttggaaa
ataggattggggcacttatgtatatcattggagatctaatcatttacttttgcccaacag
CAGATAATGAAAAGACTTATAAAGCGGTATGTTTTGAAAGCACAAGTAGACAAAGAAAAT
GATGAAGTTAATGAAG
gtaagcatctccaacttaaaaaatatccttttatagctaacttaatgaacctggaaaact
taatgttgaggcatattttaaaaatccaatcccaggttatagtttggatgcctctaagat
gggaggaggatcttatgttacgtttctaaaacttcatcttttaaaataaacagttattta

Exon 16 +      54779      54921   1   Terminal    143    95   Excellent
caaaggtcagtgtacctttaaagacagatgtttcttaaatattttaaagaaaaaactttg
aagtagctaccttggagaccttatgaagcaaatacattgatattgtaagaatttcactct
ttgttcatttctaaatccaaagagcaacttaccaataattttttaatatcaatactatag
GTGAATTAAAAGAAATCAAGCAAGATATCTCCAGCCTTCGTTATGAACTTTTGGAAGACA
AGAGCCAAGCAACTGAGGAATTAGCCATTCTAATTCATAAACTTAGTGAGAAACTGAATC
CCAGCATGCTGAGATGTGAATGA
tgcagcaacctggatttggctttgactatagcacaaatgtgggcaataatatttctaagt
atgaaatacttgaaaaactatgatgtaaatttttagtattaactacctttatcatgtgaa
cctttaaaagttagctcttaatggttttattgttttatcacatgaaaatgcattttattt

Exon 17 +      55764      55898   0    Initial    135    87        Good
tcatagaattatttaaaacaacacattaaagatttttctaaaatatagactgcttgcttt
ctgtcttagacttacgtttgttgtttttcagtaatgtgattttcttttaagttgggggtt
atgcagggttgtcattttgttataaccatctaatttctgcctctgctgctttaatgctaa
ATGAGATATCAACAGCTGACTTCATATCTCACCTGTGAGCTCCCTGCTGAGTTTTGGAGG
GTCTGCTCATGGGAAGAAATAGGAAAGAGCAGTGACTATGGGCGTACTTGGAAAGACATG
GCCAAGCATCCCCAG
gtgtgtttcagttccttttggggcatttattgccatcgttgcttacaatgattgacatct
ttgtttcttatcaaaggattccagttccactttctatataaaatatattgtgatatatct
acatatgccttattacataattgtgctgaatgctggtaatatccgcaatgcctcttgact

--------------------------------------------------------------------------------