--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (26029 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (20 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        260        529   0   Terminal    270    64    Marginal
ctgaacttgggttcccgtcacctgcaagtcagtgccggcggcgcccctaagcgcgctcag
cccacgccgcggtccctctggatgaggaccggcgcctctccccagctgcgcccaggcgct
ttcggggcctcggggagctggcggaggcctcctcctgacctcccagcaagccctgcgcag
GAGAGGATGCGGCCGGCCGGCCCGAGCAGCCTCACCGAGCGGCAGCAGCGAGTGGCACAA
CAGCGTGGCGGCCGTGCGGCGCAAGTGGAAGGGCACGAAGGCGGCGTCCTCGCTGCCCAG
CCAGCCCGACAGCAGGTTCTGCACCGTGAGCCCCGCCGCGTGGAACTCGTTGGGCGTGAA
CACGAAGCACACGGCGAACACCAGATAGGCGAGAGTGAAGGTCACCTCGGGGCTGTCCAT
CGCGCAGCCGCCGGGAAGCTGTCGAGCTAG
gcccccgccccggcgcgcggacgaggccgcagcgcccagtcccggacctgtcggttgcgg
cggccgccgcccggccgcccgcggggcactctaggacatggagtcccgccgcccggccgc
ccgcggggcactctaggacatggagtcccgccgcccggccgcccgcggggcactctagga

Exon  2 +       3084       3245   0    Initial    162   100   Excellent
tggggactcagtctgaggctttctctgccaagagacacgtgtgggaggtgtgagttccag
agcaatgagcacacctgtgtgggaagtggtcgtgccccttgcagcagctgtcacgtctgt
gtctggacaatgtggtagtgttgccctcacactgacacaaacatgttctgcttttccaga
ATGAGTCTGCAGGTCTTAAACGACAAAAATGTCAGCAATGAAAAAAATACAGAAAATTGC
GACTTCCTGTTTTCGCCACCAGAAGTTACCGGAAGATCGTCTGTTCTTCGTGTGTCACAG
AAAGAAAATGTGCCACCCAAGAACCTGGCCAAAGCTATGAAG
gtaagtgtgacctgtacagtgtgtggctggccaggttgccctagggcctgctttcttggt
gacctctgagctgcaggacactgctggtgtggctgtaacagcttgaactaatgaataggt
gctctcctcctcactccgcaacaggtgacttttcagacacctctgcgggatccacagacg

Exon  3 +       3390       3532   0   Internal    143    79        Good
aatgtgccacccaagaacctggccaaagctatgaaggtaagtgtgacctgtacagtgtgt
ggctggccaggttgccctagggcctgctttcttggtgacctctgagctgcaggacactgc
tggtgtggctgtaacagcttgaactaatgaataggtgctctcctcctcactccgcaacag
GTGACTTTTCAGACACCTCTGCGGGATCCACAGACGCACAGGATTCTAAGTCCTAGCATG
GCCAGCAAACTTGAGGCTCCTTTCACTCAGGATGACACCCTTGGACTGGAAAACTCACAC
CCGGTCTGGACACAGAAAGAGAA
gtaagtgttggtgctgctggacatgctggagcttcaccctctctgtccgatggttcttgc
aggaaagtgctgtcttgttctatcaggccttggctggattttttgtttgtttgtttgaga
tggagtctcgctctgttgcccacgctggagtgcagtggcgcgatgtccgctcactgcaag

Exon  4 +       5431       5555   0   Internal    125    76        Good
atcccctgcctctcccctatgcctccaggatcacccagcagcctccatagggcagagggt
gtagaggagctgggaggggcttgagaggttggccctgaggggctccagccagagtgactc
tgagcttgtggcttggactcgtggctgtcatctcctttctggaactctgctgaggcccag
GTGGTGGTCACTGTGGTGCTCCCACGTCAGTGGGATGAGACCAAGAGCAGCCGCTGCGTG
CAGCTGCCCACGTGTCATTCAGAGGACAGCCGAGTGGCCGCCTGGGAAGGCAGTGCCGCC
CCAAG
gtggcagctgggcagcagaggagttgtgagcagtctgacaggtccctcaccctcagtttc
tcagttttgacatcttcaaacttagagttggaagagaagggcaggtgacatgggcccctt
atctgaggcactggcacatgaccctgcgtcttctcagggacctgaaggctggggaacagg

Exon  5 +       5818       5858   0    Initial     41    79        Good
tagagttggaagagaagggcaggtgacatgggccccttatctgaggcactggcacatgac
cctgcgtcttctcagggacctgaaggctggggaacaggtgaaacagtgtttgtgccctct
gtgttgtagtccagccccaaccatcccaacagccgcctcttctgtcaggggccctgcgcc
ATGCAGTCCCACATTGTGAGCAGCGAGTGCCCCAGAGACAG
gtgggtccctgggaaggtgttctctgcacctgtgccactccactgtagcaggcgccatcc
cagggaggcgtcgcagaggccactcaggtccttctgtgcctgcaggtggcatcctgcacc
tcagccctgcccttcagtgaaggctttgactgtccctggccacagcactgccagtccccg

Exon  6 +       7377       8449   0   Internal   1073    58    Marginal
aaggaactacattgaggaactgaggtggggggtggagaacgggaagccgtgccaagggtg
actcagccctgcttctggtgtgagaatgttaaacctatgttgagaatgaatgctgaggcc
cctaacctcaccaggtactcgctgcttcacgttgattaagtctcttttaaaagccaacag
CTCATCAAGGAAGTGGATGCCAAAACTACTCATGGAATTCTACAGAAACCAGTGGAGGCT
GACACCGACCTCCTGGGGGATGCAAGCCCAGCCTTTGGGAGTGGCAGCTCCAGCGAGTCT
GGCCCAGGTGCCCTGGCTGACCTGGACTGCTCAAGCTCTTCCCAGAGCCCAGGAAGTTCT
GAGAACCAAATGGTGTCTCCAGGAAAAGTGTCTGGCAGCCCTGAGCAAGCCGTGGAGGAA
AACCTTAGTTCCTATTCCTTAGACAGAAGAGTGACACCCGCCTCTGAGACCCTAGAAGAC
CCTTGCAGGACAGAGTCCCAGCACAAAGCGGAGACTCCGCACGGAGCCGAGGAAGAATGC
AAAGCGGAGACTCCGCACGGAGCCGAGGAGGAATGCCGGCACGGTGGGGTCTGTGCTCCC
GCAGCAGTGGCCACTTCGCCTCCTGGTGCAATCCCTAAGGAAGCCTGCGGAGGAGCACCC
CTGCAGGGTCTGCCTGGCGAAGCCCTGGGCTGCCCTGCGGGTGTGGGCACCCCCGTGCCA
GCAGATGGCACTCAGACCCTTACCTGTGCACACACCTCTGCTCCTGAGAGCACAGCCCCA
ACCAACCACCTGGTGGCTGGCAGGGCCATGACCCTGAGTCCTCAGGAAGAAGTGGCTGCA
GGCCAAATGGCCAGCTCCTCGAGGAGCGGACCTGTAAAACTAGAATTTGATGTATCTGAT
GGCGCCACCAGCAAAAGGGCACCCCCACCAAGGAGACTGGGAGAGAGGTCCGGCCTCAAG
CCTCCCTTGAGGAAAGCAGCAGTGAGGCAGCAAAAGGCCCCGCAGGAGGTGGAGGAGGAC
GACGGTAGGAGCGGAGCAGGAGAGGACCCCCCCATGCCAGCTTCTCGGGGCTCTTACCAC
CTCGACTGGGACAAAATGGATGACCCAAACTTCATCCCGTTCGGAGGTGACACCAAGTCT
GGTTGCAGTGAGGCCCAGCCCCCAGAAAGCCCTGAGACCAGGCTGGGCCAGCCAGCGGCT
GAACAGTTGCATGCTGGGCCTGCCACGGAGGAGCCAGGTCCCTGTCTGAGCCA
gtaagtgtgaggatgggatggggagcgtggcgtggggcagctgccctgcagtgtatgtgg
tccaggacccgaggccagaagtgtcatcagatactcctttgaggccgggtaggttctgcc
tgaggaggggcctctggataaaaacagggctcaggtggctcccagctgagggtgcttggc

Exon  7 +       8000       8449   2   Internal    450    62    Marginal
tggtgcaatccctaaggaagcctgcggaggagcacccctgcagggtctgcctggcgaagc
cctgggctgccctgcgggtgtgggcacccccgtgccagcagatggcactcagacccttac
ctgtgcacacacctctgctcctgagagcacagccccaaccaaccacctggtggctggcag
GGCCATGACCCTGAGTCCTCAGGAAGAAGTGGCTGCAGGCCAAATGGCCAGCTCCTCGAG
GAGCGGACCTGTAAAACTAGAATTTGATGTATCTGATGGCGCCACCAGCAAAAGGGCACC
CCCACCAAGGAGACTGGGAGAGAGGTCCGGCCTCAAGCCTCCCTTGAGGAAAGCAGCAGT
GAGGCAGCAAAAGGCCCCGCAGGAGGTGGAGGAGGACGACGGTAGGAGCGGAGCAGGAGA
GGACCCCCCCATGCCAGCTTCTCGGGGCTCTTACCACCTCGACTGGGACAAAATGGATGA
CCCAAACTTCATCCCGTTCGGAGGTGACACCAAGTCTGGTTGCAGTGAGGCCCAGCCCCC
AGAAAGCCCTGAGACCAGGCTGGGCCAGCCAGCGGCTGAACAGTTGCATGCTGGGCCTGC
CACGGAGGAGCCAGGTCCCTGTCTGAGCCA
gtaagtgtgaggatgggatggggagcgtggcgtggggcagctgccctgcagtgtatgtgg
tccaggacccgaggccagaagtgtcatcagatactcctttgaggccgggtaggttctgcc
tgaggaggggcctctggataaaaacagggctcaggtggctcccagctgagggtgcttggc

Exon  8 +      10549      10624   2   Internal     76   100   Excellent
ggtgaggcagttttgtggccaggtcgcttgggacagccccatgcctggcacgctctagct
gaatgttcacgtggccggcacagcagtgcagggaaaggcgatggcagctcagtgctggag
caggggacgccggggttatggggtggggggcatgggcctctgctgactctgtctccccag
GCAGCTGCATTCAGCCTCAGCGGAGGACACGCCTGTGGTGCAGTTGGCAGCCGAGACCCC
AACAGCAGAGAGCAAG
gtaaggggtgcttgtgtgggtacctgtgctcctggcctggtcgtgtagaagagtagcagg
cagtggaagcccccagcagccttgggtgacggggtgggatgtcccgctccctctccccca
agtctacttcaacaaggttgtggggaggcaaagccacaccccaagtaccttgactgcact

Exon  9 +      10883      11054   1   Internal    172    51    Marginal
gccttgggtgacggggtgggatgtcccgctccctctcccccaagtctacttcaacaaggt
tgtggggaggcaaagccacaccccaagtaccttgactgcactgcacagggtgactctgcc
ctttcctccaggagagagccttgaactctgccagcacctcgcttcccacaagctgtccag
GCAGTGAGCCAGTGCCCACCCATCAGCAGGGGCAGCCTGCCTTGGAGCTGAAAGAGGAGA
GCTTCAGAGACCCCGCTGAGGGTACGTTGCCTGGCACAGACGTCACACACAGTCTGCCCG
GAGGGGATCCCGTGAGCACTTGGGCAGCTCGAGACACCTGCATCATCGGCAG
gtggtcatttcgcaggcagttgggtcccttgactttgaatgactcatgcacaaacttgtg
gtttgtcaaaacttagtcagtgttaggagagcagggctcatacctttaacataaaagact
tctagaaatggaaactgtagactcaggaaaatgagcaggagaggtgaacaatgcagtgcg

Exon 10 +      12313      12447   0    Initial    135    94   Excellent
aaggtggaacggtccttaaattaaagtgcatttggtaggaattgatggctgagttgtttt
aaaggacacacagccaggtgggtataagatctcaatttagagaactgaaaacccaggcac
acagcagacacgaatggcatgtagggtttgtcgctgacaggatagttgtgggccgccacc
ATGTGGGGATATCAGCTCAGCTGGGATGGGCCTGTCACCCTCACGCAGGATCCCTGGAAT
CACACAGCACGGCCTTCTGTGTCCGGCGTCTCCCTCGGGGAGGTGTGTTTCCGAGTCCTG
GCCATGCTGGAGCAG
gtgtgggtgctcctgtccttgccgtggcagcttggcttcacatcatcttatccattcatt
catggatttgctggtttctgctttttagctgtcaggagtagtgctgcctcgaatgttcag
gtgtaagttctatgtggatgtattcttccatttctcctggatacatagctaggagtggag

Exon 11 +      15393      15496   0   Internal    104    96   Excellent
aaactctgacacgctgtgctgctgggaatggtggtgtctcgggcagggttgtgggtgacc
gggggtgggagtgtgcgggtgaccgggggtgggagtgtgcaggtgacctccctggccctt
agcccccgtgtgtgttaggggatggcagtcagacctgatcacttgccctcttgtccccag
TTTAAGGAGTCGGCCTTGAGGAAGCAGTCCTTATACCTCAAGTTCGACCCCCTCCTGAGG
GACAGTCCTGGTAGACCAGTGCCCGTGGCCACCGAGACCAGCAG
gtatgtgcgccggccctccctcatgcatgaagccttgagtgtgggaagactggaggctgt
tcctaggtgtgctgtctgcacagaggcttctagaccggggggagatgatcagaactggaa
aggagctgtgctaggggtgggctgggcagcaaggccagagcagcccttgtgtgtctggca

Exon 12 +      16904      16990   0    Initial     87    69    Marginal
acggagcagcagagaggccgggcatgctggatgcgggtctgcgttttctaccactaccct
gacttgagtggttttaaactaaaaagcaaagagcccggttagcttgtccacatggtcctc
tgtgtcctactcaacactgggagggcctagtgactgaggctgcctctgcttggtggcagc
ATGCACGGTGCAAATGAGACTCCCTCAGGACGTCCGCGGGAAGCCAAGCTTGTGGAGTTC
GATTTCTTGGGAGCACTGGACATTCCT
gtaagtccttgagtccctcttgaactgtcttgtgtgtggtctgagggaacgagttgtttt
aagggcctatattttctattcctgggggtctgagcctttggttttgttgggggcatgggg
ccgctgtgctgttccctcgccgcactgtctcgggtccctcatgcactgtctgaggctctt

Exon 13 +      17260      17364   0   Internal    105    62    Marginal
ctgagcctttggttttgttgggggcatggggccgctgtgctgttccctcgccgcactgtc
tcgggtccctcatgcactgtctgaggctcttggcctgtgtgggcctttcctccctcacac
taggtcagaggtaagaggcaagggcgaaatgggttcctgtttcatccccatctcccgcag
GTGCCAGGCCCACCCCCAGGTGTTCCCGCGCCTGGGGGCCCACCCCTGTCCACCGGACCT
ATAGTGGACCTGCTCCAGTACAGCCAGAAGGACCTGGATGCAGTG
gtaaggacgcaggtagtagctattccacagaacctgcaggccgctctggggcttggccaa
cagtgggcaggggtccaacagcctgacccgccatccctgccatccctgcccctgctggtt
ggggtggaattgcagagagctgccggcccctggcctgtcactactgcccaggtcgctgag

Exon 14 +      19364      19440   0   Internal     77    95   Excellent
ggagcaggtggccttggcctcgacagggttcccagggtcccactggaagccccacatgga
actgtgcctctgggacattgctccagggacctcgggtgcgggctggccccatcctgtggg
gaggtcctgggagggtcagtctggcccgcctgcctgctgacttgggtgtggcctgagcag
GTAAAGGCGACACAGGAGGAGAACCGGGAGCTGAGGAGCAGGTGTGAGGAGCTCCACGGG
AAGAACCTGGAACTGGG
gtaaggaggccccgtctcctgtcctccccgtccccatccccctcgccatccttgtcccca
tccccctcgccatccttgtccccatccccctcgccatccctgtccccgtccccatcccca
cctggcctgggaccgctgggcacccgaggcaatggctgtgtgtctgttctcctcccacag

Exon 15 +      19621      19664   2   Internal     44    99   Excellent
gtaaggaggccccgtctcctgtcctccccgtccccatccccctcgccatccttgtcccca
tccccctcgccatccttgtccccatccccctcgccatccctgtccccgtccccatcccca
cctggcctgggaccgctgggcacccgaggcaatggctgtgtgtctgttctcctcccacag
GAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGG
gtgagtgcccgggccaccgaggccacgtgcctccacgaggggctgcctatgccccaccct
ggccctgccctgcaccctgcctaggaccccaccctcctgaggccccttttcctaacacac
gagtcccttcaacatgggcccggccgtggaagcactgaggcgagttgcggggaagctggt

Exon 16 +      20499      20648   0   Internal    150    98   Excellent
ccggcctagaagatcctgggtggagggacccatcaccctccgaggctcacacccactgcc
cacctctcctcctggcgctcgagtcccttgcctcattccttgggctgtctctggcaccca
tcgtttcggttgcctcctcatcctgaacgtttgcttttcttttctcaagaggaagttcag
AAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGAAAAAGACCAACTT
ACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGCGTTTTGAGAAA
CAGAAAGAGGTGATCGAGGGCTACCGCAAG
gtatgtctccgccaccctggtgtcctcacctcggaggctgatggactcatggtccaagcc
agcggggctacaagctgctgtctttgcaccttggtccttggccaagcctccccttgccac
gggggcatgggatgacctgtgaacgagacagggtgcaggagtcacagcatagctggtttg

Exon 17 +      21246      21322   0    Initial     77    67    Marginal
acggctgtgcaaggccaccctggtgtcctcctggccacgggactctgagcgccccccacc
ttctgtgctgggcaaggcccacatgcttgctggaaggagggatgtctgggccatccatct
gcccagagcaggcctggaaggtgcctgcgaggccgccagagggttctgcccacagcagca
ATGTTGGAGCGGAGGTGCTCAACGCCTCCTGTGGAGGAGCTGGACCTGCAGGTGCAGCTG
GAAGAGGGGCTGTCACT
gttggtgcaagggggttggggacaccagatgggtcccctgggagtcagactaaactggaa
aagcggcccttgcagggcctgctgagccacacctcatctgagtcctgaagtcaggtgggt
gtcagtggctggggcccagctgcctaacagaagcaagcctgaatactctagggaagaagg

Exon 18 +      24180      24286   0   Internal    107   100   Excellent
tccagagggggtgagctgggaacttgtgtgaaggggctttttccaaaaggaaaacgggag
ctactggctcacggctgatgccccagacagcctcgaggatctgcaggtccccagacacca
agcctgggtgctctccagcagacggcgtggtacccacagctaatgcctgccccttcctag
AACGAAGAGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGC
CAGAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCT
gtgagtgctgggcgaggccccaccctggagggagaatctgagcacctgggccccagctca
gcctctgccccgcccctacccctccagggcaaacgaggagatcgcccaggtccggagcaa
ggcccaggcggaagcgttggccctccaggccagcctgaggaaggagcagatgcgcatcca

Exon 19 +      24374      24494   2   Internal    121   100   Excellent
gaagaagtgcgtggaggattacctggcaaggatcacccaggagggccagaggtaccaagc
cctgaaggcccacgcggaggagaagctgcagctgtgagtgctgggcgaggccccaccctg
gagggagaatctgagcacctgggccccagctcagcctctgccccgcccctacccctccag
GGCAAACGAGGAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCA
GGCCAGCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAA
G
gtgggtgcgggaagcccagctcaaggggccgtctggcagcaccttctagaaggcccttgg
gcctgctgctccctccaagcagggagaagccccgcaactcatcttcctcctccagactaa
agagaacgaggagctgaccaggatctgcgacgacctcatctccaagatggagaagatctg

Exon 20 +      24577      24675   0   Terminal     99    92   Excellent
tccggagcaaggcccaggcggaagcgttggccctccaggccagcctgaggaaggagcaga
tgcgcatccagtcgctggagaagacagtggagcagaaggtgggtgcgggaagcccagctc
aaggggccgtctggcagcaccttctagaaggcccttgggcctgctgctccctccaagcag
GGAGAAGCCCCGCAACTCATCTTCCTCCTCCAGACTAAAGAGAACGAGGAGCTGACCAGG
ATCTGCGACGACCTCATCTCCAAGATGGAGAAGATCTGA
cctccacggagccgctgtccccgcccccctgctcccgtctgtctgtcctgtctgattctc
ttaggtgtcatgttcttttttctgtcttgtcttcaacttttttaaaaactagattgcttt
gaaaacatgactcaataaaagtttcctttcaatttaaacactgaagccgctctggtcttg

--------------------------------------------------------------------------------