--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45614 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        573        723   0    Initial    151    51    Marginal
ggaagtggagcggacagggtatggcccaggttaggaagtctggcgctcttgcggcgcgcg
ggaccccaggggctgcttaggccagagcgaaacgaggggtccccccgcgccaacgcagga
cccatatctacccctcccgctcagacgggaggacgcggtgtgccgggatggggggccgct
ATGCTGGCTGCGCCGCCACCCGGCCTAGTGCCCTCGCCTCCAGGGGCCGGCATGGCCCTG
TCCTTCGGGGCGGGACCCTGCGCTCCCGTCCCCCCAGTGGTGACGGGGACTCCCGACGCC
GAGCAGCGCCGTATCTGGGGAGCGCCGCCCG
gtacgcagggaagaggcactcagagctgcgcgcgccagagtgcagaccgccgagggcaga
gccacagagcaggggggccggcgagggaccgcggccgagggcgtcgagggcgcccctcca
tccccagcgtcccctgacttgcccttggagccccaagctcccaggagccgttttctactc

Exon  2 +       3815       3906   0   Internal     92    60    Marginal
gatgagtgatacaccgagtggagtgctgcaggcccctgctattaacatcttagatgagta
gggttcgttgtcacagttaatgaactgaccttgatctgttactgttcactaaagtccata
acatattcagattttctttactctcccgttctccattctgaggtcctttttctgtcccag
GACCCATCTGTACCACCCTTCTTGATTGCCTCTCAGGCTTTCCTTGTCTGCAGTGACCTT
GACAGCTTTGAGGAGTACTGCCCAGGTGGAGT
gtagggtgctgctctactggtatttcttgatgtttcctcataattaagctgggaaagatg
gtttttcaggaggaagaccacagaggtgaagcatccttatcatatcccgccgaggctcca
tgctgtccaaatgatttgtcactgttgatgttgaccttgatcagtaggctgaagtggtgt

Exon  3 +       6985       7049   2   Internal     65    79        Good
tgagacagagtcttgctctgtcgcccaggctgcagttcagtggtgcgatctcagctcact
gcaagctccgcctcccgggttcacgtctgtgctgggattacaggcgtgagccactgcgcc
cggtccggttgtagtaattcttacagctcttgccccttgggatcattgcttgctctatag
GGCTGTCTGCATAGAGGTCATGTTTCCACCAGAGCCAGCTGAAGTGAGTGGGGATGGTGC
CACCG
gtaggagtgctccctccctagggctggcctgcttggcttccctcttggggtgtctggagt
caggatctacttgaggcttcccatctttttttaggactactttgagatactgttttcata
actggggcagacccttcacttagcagtgctctgaaaccttccaacactcagaactggctt

Exon  4 +      15755      16101   1   Internal    347    67    Marginal
ctgttggtgttcggtgctgagctgtcaaaggctagtgctggctcttactactgttttcca
ctcttcccttttcaaggaatgttccatttggctgctgcactcccatccaccctgtgtaca
catcctccagaggcgatcacctcggctgttgggctctgaggcccgagtgccttcgcatag
TGTCGAGAGCGCCATGGACCTCTACCTCTGTGGGTTTTGTGGCTGTGGGACCTCAGTGCC
TTCCTGTGCGTGGCTGGCACTCTTCGCGCCCTGTTCGCGATGACTCGGTAGTAGAGAAGT
CCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCC
CCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGC
ACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCT
GGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAG
gtaatggggacatgtctagtcctttcttttctttcttgctctatcacccaggctggagtg
cagtggcgcaatttcctgggcatgggcgatcctcctgcctcagcctcccgagtatctggg
accacaggcatgtgccaccacacctggctaattgttttttatagatccagggtcccactt

Exon  5 +      20583      20702   2   Internal    120    53    Marginal
tacttgggttttttcctaatgattgctttgtagtatagtcttaggaaacacaagagaagc
cctccttatagagcaccctccaagagaaggtgtggctcagcctatcctggtgactctcca
ccacgctagtaatgcccagtcctcagcctgcagccctcacttgctggcccccgagcccag
AGTGCTGGCCGGTGTCCTCGGAGGACTCGATCGCTGGGAGCACCCAGTGGCCCTTGGTGT
CAGCACCATACCCTGCTTTTCTGGAGGCTGCTGGTACCTGCTTTGGACCCTGAGAAAGAA

gtgggttttgggaatggtctgctaagtggttctggaacttagagtcctcagtgggtcctg
tgagtcgctgcctgaggttgtgcctataaaccattataggagaaatgctcacaccccttg
cccttgttcccacatgtgctctgctcccctctgatggattccgccccttccagtttctcc

Exon  6 +      20876      21019   0   Internal    144    96   Excellent
gaaagaagtgggttttgggaatggtctgctaagtggttctggaacttagagtcctcagtg
ggtcctgtgagtcgctgcctgaggttgtgcctataaaccattataggagaaatgctcaca
ccccttgcccttgttcccacatgtgctctgctcccctctgatggattccgccccttccag
TTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTG
CCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCC
ACATTTGAGACTCAGTCACTCAAG
gtaagggcagcatcccaactgcttgttttagaatgagtctgaaattcattgtgatggctt
ccttgtttgtgacttttcaggtgctagatatttttgagactttatgtatcttcatattgt
ccttgtgctgtgcaataattatttagtggatgctgggttttggatttgtttctctttatt

Exon  7 +      22466      22603   0   Internal    138   100   Excellent
cacacgggtactttttaaaaccatgaaataaaagagtttgagaatgtattgcacttagat
gagagtcagtgtgttgtgaaatgtttctgggagtgggggtcgggcacaggcgtgagatgt
tttccttgcccgaaccacagtctgagcagttggaatgcagtgccctctctgcccttgcag
GAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGAC
ACCATCGAGGAGATGGCCTTGAAGAACAAGGCAGCCAAGGGCAGCGCCACCAAAGACTTC
TCTGTGTTTTTCCAGAAG
gtgctgtgatacgtctgagtccctgtgacctcaccagggagccttccctgattttctgtt
tccctttcgctgtgctcagcagagtggagctcccccaggtgctggctggcgcttgaaagt
ttacccaggaggctcagtcgggggccagtggagtgtcaggagtctgcccccacgagctcc

Exon  8 +      24501      24704   0   Internal    204   100   Excellent
tgcattccagcctgggtaacagagcgagaccctgtctcaaacaaaaaaaaaaaagaagaa
gtagtcagtggtttgagtccctgaggatgagaggcagcaccctttgggaatgtggttggt
cgtgggagggagccgggtgggcgcgtgtcccggggatgacccttgtgaccacttccgcag
ATCCGGGAAACAGGGGAGAGGCCCAGCAATGAGGAAATCATGCGTTTTTCCAAATTATTT
GAGGATGAGCTGACCCTGGACAACCTGACACGGCCGCAGCTGGTGGCCCTGTGCAAGCTG
CTGGAGCTACAGTCCATCGGCACCAACAACTTCCTGCGCTTCCAGCTTACCATGCGGCTG
CGCTCCATAAAGGCAGACGACAAG
gtgagcctggccatactccgcgccacagctctggtgttttaccttttcgtttcctgatga
taaaagcagcatgtcctcattgtagaaactctggaagatgctgaacgatcgaaaataagc
tcactaggagtcttgccacttgcagattgcagatcctttgaagatggatgtcttttctct

Exon  9 +      25626      25698   0   Internal     73   100   Excellent
atactaggagctcttaagatttcagttctcaggtaaaactgttcctcttgtcatctgtct
ttttgaatgcactaactctagttcacattgattactctaataactgggtggtccgtaggc
ctttttcttttgctctcccttctgattttgtttgtagtgtttagtttttcctgaatgcag
GCATTGTCTGTGGAAGACAAAGAGGTTCAGGGCAGTGTTGAACTCTTCCAGGAAGAGCCT
GCCTGCATCTCTG
gtgagcaggttgagggccagtcatttccatgaatcaaggcaaggccatgtggggagcctg
tatcccgcccttgccgggacacaacaggcaccccagccctggtggtgatggtgtcagaga
aggctgagggggccagcccctgtggtgtcagtggagaccaggtggggggcttgagctttc

Exon 10 +      30904      30951   0    Initial     48    70        Good
gagcccagcttagtgggcgaagggttcggctaaggagggcacgcatgctgcagaatgccg
catggcagtgagaggcctaacccggcacacccatagcacccccagtgggtcctcagggaa
ccccagaggtgactcctgcatgatcctgttcagagagcactccaggtgacagcagcagac
ATGGAGACAAGCGCGTCTGTGAACGGGCAGCACCGGGAGCTGGGGAAG
gtggcctctgtcttgactgggtgggtggcatgtgctaattgcagtgctgctggtgagaca
ttatgctaggggaggcatctgatgcatgggagctttgttacttgttaaaactggatgtgt
gtccacagttacgtcaagtttggttttagaagtggaggtggtggtactgtctaccccaca

Exon 11 +      31834      31884   0    Initial     51    52    Marginal
tgattcttgcttggcaaaatctgttagccacttattctggagggtgttcacacagacact
gtcacccaccagcaactgtcccagatgataattcactgctttgttttctagctgattgct
gaggaaggggtggacagcctgaatgtcaaggagctgcaggcagcgtgtcgggcacgaggc
ATGCGGGCCCTGGGCGTCACGGAAGACCGCCTGAGGGGTCAGCTGAAGCAG
gtgcgtgaatattggcctggtgccaggccggcacgggctcaagggaaacatcagcctcga
aaggccactcggaggctcttcccaaactctgggccggcctggcgaggcgacactgtgacc
tctctggggacggccaggatgtttgggctgtttctcgcccttctgctcctaccgcactca

Exon 12 +      33673      33804   0   Internal    132    95   Excellent
ctctggtgttttgtttactaacgccgtcatcgggtcacgcagcacagcaacaaacagacc
ttgtagaacttgagacactgtcttctctgagagctattctggtgatgagatgggcggacc
tgctgtggggccagcagggttggggggctgcccatctgctgaacctggccttggttgcag
TGGCTGGACCTGCACCTGCATCAGGAGATCCCCACATCGCTGCTCATCCTGTCCCGGGCC
ATGTACCTCCCGGACACCCTCTCTCCAGCCGACCAGCTCAAGTCCACACTGCAGACCCTC
CCAGAGATTGTG
gtacgtgctgtcggagaccccttttacctcatctcttcataggtggctccgctcttctgg
ggtggggggaggtgtgcaagcgcactcattcctcaaccatgggcgaggagcctgcctccc
accccctcgcgagtgcccccacccagccacctgtccccttccttccatccctcctcacca

Exon 13 +      34299      34460   0   Internal    162   100   Excellent
agtcatcgggcgagcgcagagggcggcccaggggcctcccagcaattgcgggcagcacct
cggcagtgccttctgtcctgtgtgtgtgaagcccaggtggtgacggggcaggggacacag
gacacaggacagaggtgaggggcagcaggggcctctggtggcttctgggctcacccacag
ATGTACCCTCTTCTGAAGGCAAAGGAAGCACAGGTGAAAGTGGCCGAGGTGGAGGGCGAG
CAGGTGGACAACAAGGCCAAGCTGGAGGCCACGCTGCAGGAGGAGGCGGCCATCCAGCAG
GAGCACCGTGAGAAGGAGCTGCAGAAGCGCTCGGAGGTGGCG
gtaagcggtggtcctgctccgtgccgcgtggggctgtcctgagccagcctccctagaaac
ccccgcacgcccacagtcttggcctcccgcatgcttgccctgcagctctgtcctgcatgt
ttatttcctcctggagtggtcagggaggcagggtgcccgggtgtgagggctgcaactctg

Exon 14 +      35136      35267   0   Internal    132    63    Marginal
caggtgacctggcagctgcatggagcctccctagggaccttctgtggcaggtgtgctgcc
caatgtcacctgcaggcctgctcccagtgtggcctctgccatatgttctgagcttcgggg
agcaagaagactgcttctgtgtgatggcgggcgctgggctggtgtcgccttgcctttcag
AAGGATTTTGAGCCCGAACGTGTGGTAGCTGCTCCCCAAAGGCCGGGGACCGAGCCACAG
CCAGAAATGCCTGACACAGTCCTGCAGTCAGAGACCTTGAAGGACACTGCCCCGGTGCTG
GAGGGCTTGAAG
gtaatgaggcaggttctggggccctggaggctgaggagggcatggcctggctttgtggac
agttgtggggcagggatggggacaggttagctggggcatctatagccctcagtgagagga
gatggtgcaaggggttgaggatgaggccactgggcccctaggaggcttggtggttaggaa

Exon 15 +      37976      38110   0   Internal    135   100   Excellent
cgtgcagcagccagcgcagcagtgaacctgaaccccgcgggtctcttgttaccaatgact
gtccagtgagactcttgccctgggctgcccgtataatatgaacagagcagctggtcactt
gggaacaggccagttctttcccttggctcaggctttgttgtttgcccatttttatcccag
GAGGAAGAGATCACGAAGGAGGAAATCGACATCCTCAGCGATGCCTGCTCTAAGCTGCAG
GAGCAGAAGAAGTCACTCACCAAGGAGAAGGAGGAGCTGGAGCTGCTGAAGGAGGATGTG
CAGGACTACAGCGAG
gtgggtgggatttgctccctggactctgagactgcaagaagagtaaaatcgctgtactgg
ccccaaaagtatacataatacttccgtcagatacttgataagctggccaaagagtatttg
gagaggaaagcacgttataaataaaccttattcagtaacctttccacagccattccggct

Exon 16 +      40534      40721   0   Internal    188   100   Excellent
tttgtatttttagtagaggcggggtttcaccacattggccaggctggtctcgaactccta
acctcaggtgatccgcccgccttggccttgcaaagtactgggattacaggcgtgagccac
tacacctgaccccctttttcttttaagacaaactttttacaaccaaaataattttattag
GACTTGCAGGAGATCAAGAAGGAACTTTCAAAGACTGGTGAAGAAAAGTACGTGGAAGAA
TCTAAAGCCAGCAAGAGATTGACAAAAAGGGTGCAGCAAATGATCGGGCAGATCGATGGC
TTGATCTCGCAGCTGGAGATGGACCAGCAGGCTGGCAAGCTGGCCCCGGCCAACGGCATG
CCCACGGG
gtgagtggggtggtgggcgcgggagagggatcggagactcacatagggaggctggtccct
ttgctggatccgagctgggcccttctggctccaaagggcacattgtagcctctgcctggc
tgcctctccacctttgaccagcagtcccagccaggaaccctctggcatgtcagtctctgc

Exon 17 +      41631      41784   2   Internal    154   100   Excellent
gtccacgctggccctgggagctcttggcattgtatgcaggatgggatcataccttggggg
tccgtgctggaggttgcctggctcacgcggagccgcctgtgtcagtgctgaccacttgca
gccacaggtgtgggcagtgaggccctgtgtggcaggacgcctgcccgtggccacatgcag
GCTGTGCTTCCACAGGGAGAACGTCATCAGTGTCGCTGAGCTCATCAACGCCATGAAGCA
AGTCAAGCACATTCCCGAAAGCAAGCTCACCAGCCTGGCCGCAGCACTGGATGAAAACAA
GGATGGCAAGGTCAACATCGACGACCTCGTCAAG
gtgggcctcgctggggaccacgcaggccatccgccacctgctctggagtggggtggggca
gggggactgttcattgcatgtccggcaccctcctgggcagctaccccctcctgtcagggg
tttgggtctgtcactgcgactgctcctttaagccgctgctctcatttgaaacatcagaag

Exon 18 +      42875      43024   0   Terminal    150   100   Excellent
ccagggtctgtggcaccccttgggggaattggtgctctgaggaccctggggcccgcaggc
agtgattgcgtgcatgctgctgccaccccagctggggcgactgacggcgctggccccgcc
tctgcctcactgtgctgtagggcgcagccacctgagcctctccctttcccacgtgtgtag
GTGATTGAGCTGGTGGACAAAGAAGATGTTCACATCTCCACCAGCCAGGTGGCTGAGATT
GTAGCAACACTGGAAAAAGAGGAGAAGGTGGAGGAGAAGGAGAAGGCCAAAGAGAAGGCA
GAGAAGGAGGTCGCAGAGGTGAAGAGCTAG
aaccactggcctgggcacctgtcctcctgctgtgccgtcaccctggcaagggccgtgagg
gcgattgctttgtggtgattctcagtggctcatctaatattttggctggaataaatcaga
gacttccataatcaagtaaattttaattttcatcattccacggagattcagtctgtctgg

--------------------------------------------------------------------------------