--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38722 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1079       1141   0    Initial     63    54    Marginal
agggcactcgtagagaaaactacacctcccaggaagccgtgtgcgtcgccccgccttcta
ctgcctttcactgcgcgtgcgtcgtgctgtgggattcgcggacccctctggccgcgctgt
ggctgtttcaccgctccccggctgggacttggagtcccttatctttccctggtttggtac
ATGACCCGGAAGCCTCGGCTGGCCGTTGCGTCATCCATGGCGCCGGCGCAGAGCGAGAAG
GAG
gtgggaacgccgtgaagcaagagcggtcggcagagcggggaggcgaactgcagcagagtt
cttgctttccggcaggtgatggcgccccccgcggcctagaggtccagcgcccgccgcgag
cagcggacagtcctcctgttgtgtccgaccgagagtcctggtgactttgaacatgctggt

Exon  2 +       1314       1347   0    Initial     34    59    Marginal
agaaggaggtgggaacgccgtgaagcaagagcggtcggcagagcggggaggcgaactgca
gcagagttcttgctttccggcaggtgatggcgccccccgcggcctagaggtccagcgccc
gccgcgagcagcggacagtcctcctgttgtgtccgaccgagagtcctggtgactttgaac
ATGCTGGTGCCGCTAGCCAAGCTGTCCTGCCTGG
gtgagaggaaacgggcggtggggataagtggaggagttagggcaaaagggacaaggccgg
tcctgggggctgtaggcacctctcgccccttctctcatcagctttctcaggctatctagg
gcaaaggtcacgcgctgtcagcctgttgggggaccctggcttcctccctctggggttgcc

Exon  3 +       9938      10080   0   Internal    143    87        Good
tgtaaacaaacatactctactgccagttctttaaaagtctaccatatacaattatgtaca
gtacatgatacttgataataaacgactgttactggtttatgtatttactgtattatactt
ttatcattattttagagtgtactcttacttaatttttttaaaaagttaactgtaaaacag
ACACAGGCAGGTCCTTCAGGAGGTATTCTGGAAGAAGCTACCATTTGCATAGGAGATGAC
AGCTCCATGCGTGTTATTGTCTTTGATGACCTTCCAGTGGGAGAAAATGTGGAGGTGAAA
GATATTGATGATCCTGACCCTGT
gtaggcctaactaatgtgtgtgtttgtgtcttaatttttaataaaagagtttaaaaggta
aaaggaaaaaaaattttaaaaagaaagaaacttatagaaaaatgatataaaaaccatttt
ttgtacagctgtacaatgtgtttgtgttttagctaagtgttattacaagagagtcaaaaa

Exon  4 +      11052      11281   1   Internal    230    94   Excellent
acagaacctaagaatataatcatactaatacagtaatatgcttaatataattattgtgca
aaacacagggagaatttccataaataatactctaaagcacagtggatattttttaactgt
catgtgatttatcatgtgattattgggttatattaatcccagaatttttatttctcccag
GAGTGAACATGGAAAGGTTTGCAGAAGAAGCAGATGTTGTAATAGTTGGTGCAGGCCCTG
CAGGGCTCTCTGCAGCTGTTCGTCTAAAACAGTTGGCTGTGGCACATGAAAAGGACATCC
GTGTGTGTCTAGTGGAGAAAGCTGCCCAGATAGGAGCTCATACTCTCTCAGGGGCTTGCC
TTGATCCAGGTGCTTTTAAAGAACTCTTCCCAGACTGGAAAGAGAAGGGG
gtatgaaaaattgttttttatacaaagtctaatcttttgtaattgtatttcagtaattgt
tcccaaattactggaatataggaaacccttttcatgtaactctatcttttttttttttct
ttttttgagatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatcttgg

Exon  5 +      13449      13530   0   Internal     82    94   Excellent
tctgtacatctcagacagagaaaggattcacagtgacaagttttataaaggaaatgccaa
aagaaaattaggggggagttctttttttgtcatcagagtacattttatagtttttttgta
tttatatttacacttgcaaatataaactaaaaacatttctttttcttcttttatttctag
GCTCCACTTAACACTCCTGTAACAGAAGACAGATTTGGAATTTTAACAGAGAAATACAGA
ATTCCTGTGCCAATTCTTCCAG
gtaaggtatagtgaatatgcatagaactatggaattccacagctggaaggaactacattt
catctgacgaaatttcctccttttacagacaagaactgagacccagatatttgaaggact
tactcaaagctatacagctagctggtgggaaagcaggactagaactcagttcttttgtct

Exon  6 +      13958      14076   1   Internal    119   100   Excellent
tgtttgtaatgtaataaattagaactctagaccaaaattgtagaaaataagttgaaagtg
tgaccatcaatgtagcacttatgtagaaatacatattgattcgaaattttaaagtattta
tgtttttgtaatgtcttatcaataaaaagtcagatttataaattaagcatatatttatag
GGCTTCCAATGAATAATCATGGCAATTACATTGTACGCTTGGGACATTTAGTGAGCTGGA
TGGGCGAACAAGCAGAAGCCCTTGGTGTTGAAGTATACCCTGGTTATGCAGCTGCTGAG
gtttgtatagttttgttttgttttaatatttataggaactctctttttttaataagtgga
gaattttataaagttgaagaaataaatattttttaaaagccatgggattttagaattata
agattagaaggaatctttaaagtatctaatccaaagagtacttgaattcctcatgttgta

Exon  7 +      19205      19351   0   Internal    147    96   Excellent
aatactctggaagggagtaccttaatacatgtctctttattacctgaacattttaaactc
tgtatttctataatctagagaagatgttcaccttctaagaaacctaaggctgtttactgt
ttttttcaagattattatgaattctaaggtattaataaatttgttttttatcatttttag
GTCCTTTTTCATGATGATGGTAGTGTAAAAGGAATTGCCACTAACGATGTAGGGATACAA
AAGGATGGTGCACCAAAGGTAAACCTTTTTAATAGTTACGTGCTTAATAAAGCGACAAAC
AACAGAAAGAACTGTGTGGGCATCAAA
gtgaaaccccatctctccaaaaaaagaaaacaaaattagctgggcttcgtggtatacacc
tgtagtcctagctactttggaggctgaaacaggaggatcacttgagcccaggagttcgag
gctgcagtgagtcataatcacgccacttcatttcagcttgggtgagtgacagagcaaaac

Exon  8 +      24354      24500   0   Internal    147    94   Excellent
gtgagaagagtaagattatatgattctatatattatatatttactatgtgattctttata
atattatacatttgcactgtctcttctacatctgaatcatagttcaatttaaatctgacc
agaatgtgaatgtattttaaattgtcaaatgttgccatttaacatgtttttgcttttcag
GCAACATTTGAGAGAGGACTGGAACTACATGCTAAAGTCACAATTTTTGCAGAAGGTTGC
CATGGACATCTAGCCAAGCAACTATATAAGAAGTTTGATTTGAGAGCAAATTGTGAACCT
CAAACCTACGGGATTGGACTGAAGGAG
gtatcctggtttgtttctgtaattttaattttgaaagatggaatttaaatttatttgtat
tatcaggtagtttataatactgatttaattttagttatattttttcattgtcttgaaatg
ttcattatgactaaaacttatttgcgatatttttcaaggggctagaagatattactgatc

Exon  9 +      26416      26527   0   Internal    112    89        Good
gccaccgtgcccagccttctttgatatttgaagtaattttgttgtattcttatatcacag
tttttcacttgtaattttcataaataagacattaaacctggcaagttttatgcattgtgg
tgacataaaaacatttttaaaatactgcaggacttttttgtttgctttttttttttttag
TTATGGGTTATTGATGAAAAGAACTGGAAACCTGGGAGAGTAGATCACACTGTTGGTTGG
CCCTTGGACAGACATACCTATGGAGGATCTTTCCTCTATCATTTGAATGAAG
gtgaacccctagtagctcttggtcttgtggtaagttatattcccattagggaaaattctg
ctgctagagttatattaccatcagtgttataaaataagggttttgaatctgaagactgta
aaatgctttttatttaaagctttctaattttatcaatatgtaaagtgcttatggctgctg

Exon 10 +      33670      33775   2   Internal    106    75        Good
ttctgccacttggatgaaaactccgagactagaggtattgcttagtgtgaatcctacata
cctggcacacggtagcgactccatagatatttgataaatgagtcttaattcttagaatcc
ccagtaaatgttcctctagttagaggtatgtaaccaggttatgccttcaaatctttgtag
GAATGGAGGCCTAGCGTGGGGAGATGAAGTGGAAAACAGAAAGGGCAAAGGGTACTACTT
CAGGGAGAATGGAATAGCCAAGATGGAGTGCAGTGGCTGGGTAGAA
gtttttttctaattttcttgtcaagtatcgttccttgttggaccaccagccatacttgaa
ctgtatcatgtgtatatagtaccacacatagataatactggagccagtatatcaccaaag
actagattgagggttaaagcctaaagaaaaggggagtggagccagaacaggaaacaatga

Exon 11 +      37221      37384   1   Terminal    164    78        Good
gtacatgtaatttacactcacatcaatagcaatgcaccaaggtcttcataatctctatgg
gtaagcattcagaaagcaacctttaaggtttctgtggctactctttccttaatttttact
tttgaatttaaaaattttttaaagttaggcacttcaatattatttatttttacttttcag
GAGTTTATGAATTTGTACCTGTGGAACAAGGTGATGGATTTCGGTTACAGATAAATGCTC
AGAACTGTGTACATTGTAAAACATGTGATATTAAAGATCCAAGTCAGAATATTAACTGGG
TGGTACCTGAAGGTGGAGGAGGACCTGCTTACAATGGAATGTAA
actgcagctagccagtttctttcaagtatggcaagctaacgttaaaatgtttagagatta
acagatttcagaatgtctttctgcatattactgaacagaatagtcacaaaatgattatca
aataaaaattttatactatatgtaagattgtcccataaagaaattacgggtattgctttt

--------------------------------------------------------------------------------