--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (116893 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1907       2128   0    Initial    222    73        Good
tgtcctgaggcgtgagactgagttcatagggtcctgggtccccgaaccaggaagggttga
gggaacacaatctgcaagcccccgcgacccaagtgaggggccccgtgttggggtcctccc
tccctttgcattcccacccctccgggctttgcgtcttcctggggaccccctcgccgggag
ATGGCCGCGTTGATGCGGAGCAAGGATTCGTCCTGCTGCCTGCTCCTACTGGCCGCGGTG
CTGATGGTGGAGAGCTCACAGATCGGCAGTTCGCGGGCCAAACTCAACTCCATCAAGTCC
TCTCTGGGCGGGGAGACGCCTGGTCAGGCCGCCAATCGATCTGCGGGCATGTACCAAGGA
CTGGCATTCGGCGGCAGTAAGAAGGGCAAAAACCTGGGGCAG
gtaggaaaacccccaaacacattcttcagacagaagaggcaggggccagctctcttgggc
tagcggtttgccattgcatcttgcaacattcggagcgtggccccagatacagagaacagg
cggctggggagggattcaccgaacagggtctgcgtgggcggggggtgtctgggtggctgc

Exon  2 +      16493      16698   1   Terminal    206    75        Good
tccaaataagtttttgaaactctaataaacattctgagtcaaggattcagcattgtgatt
ataattgtaaacctttccatgtcaattgctttaaggtggaaaaccctcagttgggtttag
aaagtcttaaaatttaaaatataatggaatattattttataatctggtcttttccattag
AAGAACGTGGTCAAAATTCATGTAATATGCTTATTATTTCCAAAAGAATCATGGTGTTCC
AGAAGCAGTTAATGAACCTAGGTCAGTGGTATGTTCTCCACCCCAAACCCATGCTGTTTC
TGAAAGAGGAGGCAGGAACAAATCATACTCAGTACAATTCTCCAGAGTCCAGTCTGGTGG
CACATGTTACTTCATGTGCAACTTAG
ttaaaatgtgcgcacagagacacacacacacacaaagcctgtcaaaaattatttttaaaa
tgagttcaattgttttagattccacatgtaagtgaaaacatgcattatttgtctttctgt
gcatggcttgatttaattattctacaacgtatttaataatcataatattacttgtaccca

Exon  3 +      24650      24709   0   Terminal     60    73        Good
gttatagttcttgggttggatggtgggttcactcttgtggttgataatctaaagatgttt
aaatatattttgcatttataaaatatacttaaaatattgaaaaatatataaaatatatta
agagataatataaaagaaagatctgagaatctttgtctaacttggggaccttccattcag
GTAAGATACCTGCAGATAGGAGTCAAGGGAGAGGCAGATACCTCTGAGTACATCCTCTGA

aaagtgttattttaaaagtaatttatagagagcatatgctgcaatatcatgataaacagt
attagagaaagttttataaaagtagaacttggaccttagagaatgcagttaaagctttta
caagtttcctccaagaacaaagacaaaaccctttcccattctcacacttccccaccttct

Exon  4 +      29324      29431   0     Single    108    43    Marginal
tttggtcagtattactgctcacttcccatttccactcaaactgaaagatcttatcttttt
caccatcatacacccaatgtctagcatgataacaaacacagaatagatgtgtagtaaata
ttacttgaatgaatgaataaatgaatattgaattatacatttttaaggtccctctcaacc
ATGAAATATGATTCTATGCTGATTTTCACCTACGTGGCCTTCATGGGTTTTAATGGTGGT
GATCAGAAATTCTCTATTTTCTTTTGGCTCTGTTTTACCAGCAGCTGA
aacataagctgggacataactagtaaagagcaatggcattgaatcaaacaagtttttgcc
aggaagaaacggtcaggaggtgatatcggggactagtttgggaagctttctcactctggg
aaattgatgtttccaaagaaatcaccaagcctgtacaataacaatcaattggaatcacct

Exon  5 +      33987      34089   0    Initial    103    60    Marginal
cagtaggaaaagaatctgcaagttcagacatctggtgtatatgcttggctgaggagccaa
tggggcacaactaccatctgtggaattatgaccaaaaatctctaagtcagaatctctcca
aaggaaaatgttagggcagtgctactgatctttggttagcgctctgtgcaatgaaggtat
ATGCTGGTGAGGTTGCCCACCAAGGTGGGCTCTCCAGACCTCTTCAATCTTCTGGGGTGC
AAATTAGAGACCAGTCTTGTCCAGAGCATCCAAGAAGTAGAGC
gtgagcacaatgctagggcctaaaagatggtgaactatgcctgagcagaggaaagccaca
ggaaacttggtggaggtttgtagtggtcctgatgtgcagatcggtcatctgacctgggta
aaagagtgaaagacggaatcttctagtagttggtttcctgcaagtgttcctcagtatagt

Exon  6 +      34930      34982   1   Terminal     53    77        Good
ctaactatttcaacaaggagtagacccagaaatccaggtctagtagatagaatattataa
taacatttattttcagtttctcattcttaggccataccaaatttacttttgactcaacat
ttgttcagtgactagtggttttctcttcccttttctttttttttactgtctttttggcag
TAAAAGTCATTGAGACAGCAAAGCAGAAGCATGTGAAGCCCTCTAGCAGATAA
acattttccattcacgttttgaagaaaacaaaaaagctaaataaaagaacccaaatgaca
aacactgtaaagccatatctttgtaaaaataaattttttcggtgaagaagtctttcattt
ggaaattagatccagcttctgcttatggaaaaagcaagtaaaacgcagaaacaaccaata

Exon  7 +      43685      43770   1   Terminal     86    89        Good
aatatctttgttttgattttggctggggaagtttctttgttggtcagccacaacatttcc
attaactcatataaattctccatctcatgactcctgccaattttctccctgcccagacag
gatagataacattagcaatgttgcatgaaacatttaaaattaaaattattttccccgcag
CTTCCGACCACTGGATGGTGAACAACTTCAGTATTATTCACAACATTCATAATCAAAGCA
ATGAATTTGGGAAGACTTTTAACTAA
gaattaaaactgtatacattatattggacattatgtaaaggtttaaaacaataaaagagt
gccaaagttgcttgagagattactttttgatcttgtgaaatctagtttgcctattttggc
agctcagagcagtgatcactaagagcttatatatatattccccctttaatccctaatagc

Exon  8 +      43950      44072   0   Internal    123    96   Excellent
agaattaaaactgtatacattatattggacattatgtaaaggtttaaaacaataaaagag
tgccaaagttgcttgagagattactttttgatcttgtgaaatctagtttgcctattttgg
cagctcagagcagtgatcactaagagcttatatatatattccccctttaatccctaatag
CTTGGAGGAATCCAGCAATTCAATCTGTCAGCAATCCAAGTAGCCAACGTATTTACTAAA
TACCTGTTAGTTGTAATGGAAATTGGTCTTCGTGGATATTATGGCAATGATTTCATGGAT
AAA
gttagctgatattttatggtttaaataaactagggaaataagtttagtagtgggttaatt
gggaaacctccgtttattgaacattttagtatgtaccagccatgaggctatgtgctttac
acatattatctcttgaattcctgacaacaatgcagaaagataaatatcattcaaatttta

Exon  9 +      45062      45144   0    Initial     83    42    Marginal
aaaagctctgagaagttttgcagcaaagaaatttgtctttgttatagccagcacaaccca
tatttattttcatatacaatccctatcttcattcacaactgtcaacatctcacagagcac
aaattgaggatggctgctccagaccttcaataacagcctgaatccaaaagcaaactttca
ATGGCCAAGAGGTGGGAAGAGGGGCAGCCAGGCATGAAGAAGTGTTCCTATTCCAGAGAC
CACACTGGAGAAGATGGACTTGG
gtgagaaaagctggattccacacgttaatcagaaagttgttggccagtgcagaaacagtt
gtagaaaaatttggtacttaatcacagtccagcacttagtaaacctaaacctttagcatt
tctactccatcctaatgaacatctttcatctaataatatggtgactccggggcttagggc

Exon 10 +      49953      50067   0   Internal    115    61    Marginal
aaggtatgaagccatccagccccagggtttcagagaacaagaacttatgctcattattag
ggtgccaaaactggaatcaaagaatgaattgaattgcattcttatgcctgtctactgaag
ttgcaaataccccagaaagagtctgagtggctagttgggatcctgcgtccctttcctcag
GCAGGGGAGAGGAGAAAGCAGGATGTCCTGATTGACAGCCCCATCAAACTGCAGACCATG
CCTGAGGCCAAGTTTTCAAACAAAACATCAGGGTGGTGTTACACAAGAAAGGGAC
gtgggtgttagacaagcaagagaaattgaagtgtttaatagactcctgacttatataatt
attatgtttttcaaatgagataattgaccaaggcacacacagtgacagtatatatgttat
taataaagataattcttgaaaattataattagaaagagctcacaatctggtttattcttc

Exon 11 +      62070      62403   0    Initial    334    92   Excellent
ataataaaaaatgataaaggggatgtcaccgctgatcccacacaaatacaaactaccatc
agagaatactttaacacctctaggcaaataaactagaaaatttaaaagaaatggataaat
tcctagacacatacaccctcccaaactaaaccaggaagagtcgaatccctgaatagatga
ATGACAAGTTCTGAAATTGAGGCAGTATTTAATAGCCTAGCAACCAAAAAAATCCCAGGA
TCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAAAGAGGAGCTGGTACAATTCCTT
CTGAAACTACTCCAAATAATACAAAAACAGGAAATCCTCACTAACTCATTTTATGAGGCC
AGCATCATCCTGATACCAAAACCTGGCAGAGACACAACCAAAAAAGATAATTTCAGACCA
ATGTCCCTGATGAACATCAGTGCGAAAATCTTAAATAAAATACTGGCAAACCAAATCCAG
CAGCACATCAAAAAGCTTATCCACCACAATCAAG
gtggcttcatccctgggatgcaagtctggttcaacatactcaaatcaacaaatgtaaccc
atcgcataaacagaaccaatgacaaaaacaacatgattatctcaataaatgcaggaaagg
ccttcaataaaattcaacacccctttatactaaaagctgtcaataaactagttattgatg

Exon 12 +      64312      64484   1   Internal    173    82        Good
cacttttacactgttggtgggagtgttaattagttcaaccattgtggaagacagtgtggt
gattcctcaaggatctagaaccagaaataccatttgacccagcagtcccattactgggta
tatacccaaaggattataaatcattcaactataaagacacatgtacttgatttattgcag
CACTATTCACAATGGCAGAGACTTGGAACCAACCCAAATGCCCATCAATGATAGAGTGGA
TAAAGACAATGTGGCACATATACACCATGGAATACTACGCAGCCATAAAAAAGGATGAGT
TCATGTCCTTTGCAGGGACATGGATGAAGCTGGAAACCATCATTCTCAGCAAA
gtaacacaggaacagaaaacaaaacaccatgtgttctcactcataagtaggagtggaaca
atgagaacacatggacccagagaagggaacatcactcactggggcctgtagtggggtgga
agggtcagagaggaatagcattaggagaaatacctaatgtaaatgacagattggtgggtg

Exon 13 +      68246      68347   0     Single    102    54    Marginal
tgaatagaggactgggaagcataggaagtgatagatcaacagagagaaccattagtacta
cagagagaatcccagaaaaatagtcatgaatacagagaggtgggagcatctgagatgagc
cctgagtatgtgagatgagagatgagagatgagagaggaaaagggagaggggagggggag
ATGGGAGACAAGCAGAGGAAAGAGGGGTCCCAAACTGGAGGCGAGAAGTTTGAGCAAAAG
CAGAGCAAAGGAAGCCCAGCATCAATTCTGAGCAAAGATTAA
gaaatggcttctttgaggtcattgattcctaaattagaaaaaaaaaagcataaatcaact
tcattcttcaggaacttagcacttaattccagaaagaactgggatgtacttttgctcaaa
tgctaaaatttctttttcagtacttttgttttactttccgcatgcctataaattgaccag

Exon 14 +      73371      73476   2   Terminal    106    82        Good
aatattttttaatctcccacatacgagtaagaagatgtaatatttgtctttctgtgtctg
gcttatttcacttaatagagtgccctccaggtccatccatgttgttttcaatagcaggat
ttaattatttttatggctgaataatcttctattgtattaatttcattaataatattccag
TGAACAAAAGAACAAAGCTGGAGGCATCACATTACCTGACTTCAAATTATACTACAAAGC
TATAGTAACCAAAAAGCATGGTGCTGGCATAAAAACAGACACATAG
aaaaatgcaacataatacagaatacaggaataaatccaggcatttacaataaagttgtca
agaacatactctggggaaaggagagtctcttcaacaaatgaatggtactgggaaaaccgg
gtatacatatgcagaagaatgaaaaatagagttagaagaaataaaatctagtgtttggta

Exon 15 +      76444      76503   0   Terminal     60    72        Good
tcttaacttttgattttccaaagaaatgggaggtgagatggcaagagtcttcacaaatat
tgtcaagccaaaattagtatttaatattaatataagcattctcttttatcaaaatattaa
acttctaacaaatagatgcctatttaaaagcaattagcctcttcatgtattaacttgcag
AAAGAGAAAACTTCAGATAAAAAGAGAGAAGAGAAAGAGCGAATGCTTGGACCCTTCTAA

atatgtataattgtaatgaataataaatatacagtgacaatataattttactatttccct
caagtagagcaggcctatgatattagaataaaataatcagtagaaaggaagaaatttggg
aaaatataaaccagtccacttcattgattttatagtttaatttctcattattgttaagac

Exon 16 +      80642      80676   2   Internal     35    51    Marginal
cattgtagattctggatattagccctttgtcaggtgagtaggttgggaaaattttctccc
attttgtaggttgcctgttcactctgatggtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttggcttttgttgccattgcttttggtgttttag
ACATGAAGTCCTTGCCCATGCCTATGTCCTGAATG
gtaatgcctaggttttcttctagggtttttatggttttaggtctaatgtttaagtcttta
atccatcttgaattaatttttgtataaggtgtaaggaagggatccagcttcagctttcta
catatggctagccagttttcccagcaccatttattaaatagggaatcctttccccattgc

Exon 17 +      83928      83992   2   Internal     65    59    Marginal
ctgtgattctgaaatgtcagaaagaggttaaagtgttccacttctgaaggagaacatcct
gaatcccacagattgtctcaaattgacacagaaaaaaagtattctctcagtagcctctga
gcttctgagtgatgggtggaaagagtaggaaatctcaaagctttcccttttcatctacag
AGTGAAACGTCTGATCTGTAACCTTGAAAACTGTCAAAATGGAATTGATCCTGCAAGTGG
TAATG
gttaaagccttctttgctcccctccccaccccatatctttgtgattttttaaaagcactt
tgttctttttatgtagagcagaactgctgggaaggtatgaacagagtttacatcagaagg
gtgtgcaagctgcctttttaagttggtgctgtaagtgaatttttgtctgttttatttcta

Exon 18 +      85313      85421   2   Internal    109    67    Marginal
tttctataaggaaattaactaaagccaagagggtactttttggagtttaatatataatca
cagcattaaataaaacttctggacttaaaacagcctacgacatactctgagttgatctac
taggaagaactataaaaattgaataggatacaaaggtaaatagatttttactttttatag
GAAAGAACAGCTTAGCAATTCATTTTCAAAATGGAATGGACAGCCCCTTGAGGTAATGAT
TTCACCACTCACTGGAGCCAAGTTTGATGGCCACATGTCAAAATGCAGA
gtaaaaattcttattgcgttaaataactgctaagctcacatccaaatctaagattcttta
gttttgttgttgtttagtcaataccacaccaaacaggcagttgtttccaaatatgtgttt
ctgttttatggcatttaacaaaataagcaaattgactacattactttccatttaatacaa

Exon 19 +      89888      89967   0   Internal     80    53    Marginal
agaggggaggattgcttgagcctagtagttcgaggtcacagtgagctatgatcatgccac
tgcactccagcctgggtgacagagcatgaatccatctctaaaaaaaaaaaaaaaagaaag
aaagaaaaaagataattaatcaatttttttaaagcctacccaactcactttccttatcag
ATGGGAAAATATGTACAAAGGTTCTTTGCCAAAGAGAAGGTACGGTACAGATATGAGTTT
ATGGGAAGGCTGCTCCAAGA
gtaactattcttacctcttttcatttttcctgaaaaactgacagctctgtcatttctatt
acacagaaatttaggaagtgttgccaaacaatgtgacattttaatgaaaatactatcatt
acagtatctttcaagctgttgtcacagggtacggtacctttcaagcagctgtcacagggt

Exon 20 +      98715      98822   2   Internal    108    74        Good
tgaaatacatcccatcaatacctaatttattgagagtttttagcatgaagggttgttgaa
ttttgtcaaaggctttttctgcatctattgagataatcatgtggtttttgtctttggctc
tgtttatatgctggattacatttattgatttgcgtatattgaaccagccttgcatcccag
GGATGAAGCCCACTTGATCATGGTGAATAAGCTTTTTGATGTGCTGCTGGATTCGTTTTG
CCAGTATTTTGTTGAGGATTTTTGCATCAATGTTCATCAAGGATATTG
gtctaaaattctatttttttgttgtgtctctgcctggctttggtatcagaatgatgctgg
cctcataaaaagagttagggaggattccctctttttctattgattggaatagtttcagaa
ggaatttcctccttttacctctggtagaattcggctgtgaatccatctggtcctggactc

Exon 21 +     104051     104094   1   Terminal     44    73        Good
gatacaaaatataaagaaaatgcaaagtttgcgcattgccagcaagacataggtgtatac
cacttgaggatatgaaacaatccagccataatgggtgtgttgacagctctgagtccacac
agcgttcctcccaaagtgcactggtgtgtgtgttatgtgttattttactttttcatacag
TTGTAGAAATTCTCAACACCACCACCACCAAGCACAGTGGCTAA
gcactaggagtgaagatgaaccttcctggaaattgttgttattgtcagtgagcctctcat
ttagactcacgttgttttcagggaactaatccttcacttagacccatgtctatctggagg
taatactgagttgcattttatacagaccaggcattgtcagtatgatatatatgcaggagg

Exon 22 +     106760     106900   0   Terminal    141    60    Marginal
gcaagccagtccgatcaggtttcccaaatgtaattgccaatcttctgctgtgctctcaga
gaccccagatatattctcatccccagttctttgctgctacctccatctatccactagcct
caaatgtttttcattcccacagctgggtcgtcccctgcaggctttcttctgcctgcctag
CTGATGATGTTTTTCTGGCTCCAGAAAGCTTCCGAGATTGTTACAAACAGTGCTTGTAGG
GACAAAGGATTGTCCCGATTAAAACAACAAAAAAACGAGGACGGTCTTGCAAGAATCCAG
ATGGGTGGCCATCCCACATGA
acactgtgatgtttctctcttcttttcttcctctcatcattaaataaggacaatattatt
attttgaaaacttaggagttaaactaaggttttaattgtagtcaaaggtttattcaatga
ttttgctactgagatacccaaaacactttttctcctttcattgttcttagggatctgatt

Exon 23 +     113294     113554   0   Terminal    261    76        Good
cataatagatttatgtgataagaggcagagccaattggtatcaaccaagacttttcatta
taaatggtaacaacatagaagatagtataagtaaaaatattttatgtgcttctgattgca
aaatagaattttttttttctgaagtgtcagggtaacatctattggtcatcatctctgcag
GGCATGAAGGAGACCCCTGCCTACGATCATCAGACTGCATTGAAGGGTTTTGCTGTGCTC
GTCATTTCTGGACCAAAATCTGCAAACCAGTGCTCCATCAGGGGGAAGTCTGTACCAAAC
AACGCAAGAAGGGTTCTCATGGGCTGGAAATTTTCCAGCGTTGCGACTGTGCGAAGGGCC
TGTCTTGCAAAGTATGGAAAGATGCCACCTACTCCTCCAAAGCCAGACTCCATGTGTGTC
AGAAAATTTGATCACCATTGA
ggaacatcatcaattgcagactgtgaagttgtgtatttaatgcattatagcatggtggaa
aataaggttcagatgcagaagaatggctaaaataagaaacgtgataagaatatagatgat
cacaaaaagggagaaagaaaacatgaactgaatagattagaatgggtgacaaatgcagtg

--------------------------------------------------------------------------------