--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (59476 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1362       1432   0    Initial     71    66    Marginal
cgcgcgcgcaggcccagccctcgtcgccgccgccattttagctgttggttccggccgcac
cgtgtgggctgtagtagcgggaggggtgggggtcctccagagttaagtggctgtcctcga
ctgtgcccatacagcagccagctttcttccttaataactgcccgttcgaagagtgcgagg
ATGTCCAAGCGGCACCGGTTGGACCTAGGGGAGGATTACCCCTCTGGCAAGAAGCGTGCG
GGGACCGATGG
gtaagccaggccgggggcgcgaggcggcagctcgggctttgttggggtcctggcagggag
cgggccggggctggcctggccgagcgggtcctggagcccgagcctttgtttctctctggg
ctgggttcactagcggcgggtaggagaagcgcggcgcccgttcggcccggcaagggcgcg

Exon  2 +       9077       9184   2   Internal    108    81        Good
tgtggtggagaatgggaaacccttgattgtagggtattttttattatttctgatagttac
ataatccattggactttttattcatttgaacgttggacatttactctctttgtgattata
acgctaccgtgaacattctgcataaaattcagaatctgaattctaaatttttgtttttag
GAAGGATCGAGATCGAGACCGGGATCGTGAAGATCGGTCTAAAGATCGAGACCGAGAACG
TGATAGAGGAGATAGAGAGCGAGAGAGGGAGAAAGAAAAGGAGAAGGA
gttgcgagcttcaacaaatgctatgcttatcagtgctggattaccacctttgaaagcttc
ccattcagctcactcaacccactcagcacattcaacgcattcaacacattctgctcattc
aacgcatgccggacatgcaggtcacacgtcacttccacagtgcattaatccgttcaccaa

Exon  3 +       9077       9483   2   Internal    407    73        Good
tgtggtggagaatgggaaacccttgattgtagggtattttttattatttctgatagttac
ataatccattggactttttattcatttgaacgttggacatttactctctttgtgattata
acgctaccgtgaacattctgcataaaattcagaatctgaattctaaatttttgtttttag
GAAGGATCGAGATCGAGACCGGGATCGTGAAGATCGGTCTAAAGATCGAGACCGAGAACG
TGATAGAGGAGATAGAGAGCGAGAGAGGGAGAAAGAAAAGGAGAAGGAGTTGCGAGCTTC
AACAAATGCTATGCTTATCAGTGCTGGATTACCACCTTTGAAAGCTTCCCATTCAGCTCA
CTCAACCCACTCAGCACATTCAACGCATTCAACACATTCTGCTCATTCAACGCATGCCGG
ACATGCAGGTCACACGTCACTTCCACAGTGCATTAATCCGTTCACCAACTTACCCCATAC
TCCTCGATACTATGATATTCTAAAGAAACGTCTTCAGCTCCCTGTTTGGGAATACAAGGA
TAGGTTTACAGATATTCTGGTTAGACATCAGTCCTTTGTACTGGTTG
gtgagactgggtctggtaaaacaacacaggtgagttattgtataccatggtacatatttc
atttatgtttaagtttaccaaatgttgcatatttgattctggtggtcatttcccttgtct
gtcctatagaacatcttgaagaatagctgatttgatgtttaattggcactctgaatttca

Exon  4 +      10100      10211   2   Internal    112    80        Good
gacttttgtccatctagtcgtcctccctcccatagaactaaacactgttactagtgtgtt
atttgtaatatagctaggatattttttaaacatggatgggctattattaactagacccct
gttgatagacatttagactgtttcccatggttgttttgcatgggtcaagtgtttctgtag
GAAGCAGAAATTGCTGGGTCAGAAGATCATTTGTAATTGTGATACAGAAAGCTGGATAGC
CTTCCAGAGGGAGCGTATCAATTTACCTTTCCATGAGCATGTAGGAGAACAC
gtgggaaactattaaaacgtgaatttttacaaatccaataggtgaaaaattgcattctaa
tgtactttttaatttgcattttcttgctgtgggtgagaagtaactgtctttatacactta
agcctgaaccatcaattaaaaatttctggtttcaaaagtagcagtccctgatcattgtag

Exon  5 +      11022      11066   0   Terminal     45    59    Marginal
aaggaaaacttagaattgatgttagggtattcaaaaatcaccttacggaaattttaagaa
ttttcaaactacaagaaagactgtaactctgaacttactatttaattgatatttgggtaa
agccagacactgtatactttacatgtattagctcatttacgtttttctataaccctgcag
GAAGATATTCATCACCACTTTACAGATGAGCAAAATGAGGTTTAA
gtttatgagaaacttaggtttagtggattgtcctgggttacatggattatggattttggt
gggctcaatatttaaaactttgtaccttttgtctttatatctaaagttttatatttcata
ctgctattctgtggtctgattatgggtagcctcatttcagagatgagtttattaatggtt

Exon  6 +      14932      15101   0    Initial    170    76        Good
gcttgtgttgttacaagttttgaatcacaagtcttatagtcatttgcctaattggatttg
gttttaaatcattagaatgagataaagtgctttatgttacatatacttgatatgcaggca
gaatagaattaatttaaatgtgaaattatttgatagattccacagtggtgtgtggagtac
ATGCGATCATTACCAGGACCCAAGAGAGGAGTTGCCTGTACCCAACCCAGGAGAGTGGCT
GCAATGAGTGTGGCTCAGAGAGTTGCTGATGAGATGGATGTGATGTTGGGCCAGGAAGTT
GGTTACTCCATTCGATTTGAAGACTGCAGTAGTGCAAAAACCATTCTTAA
gtaagtactatatctttaatgacgcttttagtcctctgcttgccattttctgctattaga
tagaagactttgctagtgcaggcttatgtcatccaaatttagaattatccaaagtaggcc
ttcttagacttaccacatgaccttagtttaattatatattattggtaatctatagttact

Exon  7 +      29345      29480   2   Internal    136    93   Excellent
actcttaaaagattttcttgaaacttaattttgcaattgatcatgaaacagtagcacatt
tgtttggggcagaagtttatttttaatttaccttatgtctttgcatttcatttttgtcac
gaagtttggttttaaaatgacctaacggaacctttaaccaacatgttctttggaatatag
GTATATGACTGATGGGATGTTACTTCGTGAAGCTATGAATGATCCCCTCCTGGAGCGTTA
TGGTGTAATAATTCTTGATGAGGCTCATGAGAGGACACTGGCTACAGATATTCTAATGGG
TGTTCTGAAGGAAGTT
gtaagacagagatcagatttaaaggtgaagtaatttcttctctccatttaactatatatg
tgtgtatgtgggcataaaaatggggaatacatactgatcaataaccaactgtaagaaatc
acctgtaaaagaaggaactagtaagtaccttcttgttttgtttctgctttgctgtgcttt

Exon  8 +      30812      31042   0   Terminal    231    84        Good
tgtaaataacttttactatagttcagccattatgtatttgatttttcatttacagtttat
ttgaaggttttcatgggcatttttatagctgatatatgtagaatagtaaatattgctata
ctgtaagaccatgtaagaatccttgaagacagcttcaaataatttactgttttctttcag
GTTATAGTTATGAGCGCTACTCTAGATGCAGGAAAATTCCAGATTTACTTTGATAACTGT
CCTCTCCTAACTATTCCTGGGCGTACACATCCTGTTGAGATCTTCTATACTCCAGAACCA
GAGAGAGATTATCTTGAAGCAGCAATTCGAACAGTTATCCAGATTCATATGTGTGAAGAG
GAAGAGGGAGATCTTCTTCTTTTCTTAACTGGTCAAGAGGTATTGTTTTAA
ttttcttcattatttagcttttgacatactgtttctaatatgcagcaaccttaatcataa
gaacatgttaatcatattttttatttcaatgttcttcaacctgattgtattaatatgtaa
aatatataaccccttttatctgcatactgtaggaatacttctgtataccactagagtttg

Exon  9 +      36733      36900   0   Internal    168    98   Excellent
ggattgttttggaaatcccattgaaatttgctaaattagttttggttactaaattgaaaa
cagggtatccatgaagtgaaagaagatggcatacataaaacagactgcatagaactagga
ttataataaatactttaaaatgtttcagtattcgtttttagactcacttttattttgtag
GAAATTGATGAAGCCTGTAAGAGAATAAAGCGTGAAGTTGATGATTTGGGCCCTGAAGTT
GGTGACATTAAAATCATTCCATTGTATTCTACACTTCCACCTCAGCAGCAGCAACGCATT
TTTGAGCCTCCACCTCCCAAAAAACAGAATGGAGCAATTGGAAGAAAG
gtaacattagaaatgctctttataaatatttcactaataatgatttatgagatataaact
gtattcagttataaaggactaagttatgggtgattgtgatctaggttttatacaacaaaa
taatatccatttgtagggttccgcatatctcttgaccctaaagtaagaatgagtactgct

Exon 10 +      42729      42815   0   Internal     87    85        Good
tggttccttaaatattaatttacctttttaaagcattggccattgaagatcaaatgatat
ttctagtttatttgctggcttgaaattccttgtgtcagtgaaagttagtggctgatcttt
aacagtcctgttaattttatttgatatgtaatataatttatatactctatttcttaacag
GTAGTTGTGTCAACTAACATAGCAGAGACGTCTTTGACAATAGATGGTGTGGTGTTTGTG
ATTGATCCTGGATTTGCGAAACAGAAG
gtacatatttagtggatactttataaattagagttggtttaacagtacttacaaccaatt
catttaatggctaaaatttacctttcagaattattttcctatctttttttttatttgcaa
atttctgctgtatgaaccctttatgttttggctggctctcagaaattaagacagtattta

Exon 11 +      43733      43882   0   Internal    150    96   Excellent
gaatgtctgaaagaactttaaggttcaggatggtgggttgtctattgtagcagcatgatt
tatggctatcgatatttctttatttattttggaattaactgtgggctttggatacttctg
ttgcatcacaattttgtgtttgactgaagaaagactcttgtgttatttcaattccaatag
GTCTACAATCCTCGAATCAGAGTTGAGTCCCTTTTGGTGACAGCTATTAGTAAAGCTTCA
GCTCAGCAAAGGGCTGGTCGAGCTGGACGTACCAGACCTGGAAAATGCTTCAGACTTTAC
ACAGAGAAAGCTTATAAAACAGAAATGCAG
gtatggggtattgtcgtttcctgccgatatgtttaaaatgttaggttgaattatcttacc
agaagaacattgccttatttacttaatcttgccttttaggattaaaagctccttagcttt
tccaggagtgaaatgtatggtgtaattaacttagatagtcgtacacccccttattccagg

Exon 12 +      44807      44915   0   Internal    109    94   Excellent
aaagatagttggagaaaaatggtttctctctagtctagcctacaagtatttatctctact
gagacagtgtagaagtaatgccaaaacaaatagctcaggaggcagcagatttttgttttc
tggaacgaggagactgaggcatttttaacataaccaataaatgtttttgttctttgctag
GATAACACCTATCCTGAGATTTTGCGTTCTAATTTAGGATCAGTTGTGTTACAATTGAAG
AAACTTGGTATTGATGACTTGGTACATTTTGATTTTATGGATCCACCAG
gtatgacttatcaaaacacatttttatcagatcttttaaccaaaattgactcttagtgtt
tttctccatcctatttaatatatgtattaaatacattttgctttttccatccagtatgca
tcaagattaagtcttacatgatagcattaaaactaaaaaaggtgacagttatatgagcac

Exon 13 +      45456      45608   1   Internal    153    78        Good
ttttgcaatgtttttatgattcattgtttgctagatctgtataattgaattggatgacag
tttgagtttgagtttggtccactgcaaaatgaaaaatgagattgcttataatagtttgta
ctttgtcacatttttgcttgcttaaggcaccgtgtctaatagattgtcttttaccactag
CTCCTGAAACTCTGATGAGAGCCCTGGAACTTTTGAATTACCTGGCTGCTTTAAATGATG
ATGGAGATCTGACTGAATTGGGATCCATGATGGCAGAGTTTCCTCTAGATCCACAGCTCG
CAAAAATGGTTATTGCAAGTTGTGACTACAACT
gttctaatgaggtcctatctattactgctatgttgtcaggtaatagagggaaaggaacaa
aaaaaagcccagctcttcaaagtttgggtggacttcacttttgtttttgttttttaattt
ttagtatgatagtggattttatagatggttttaaggaattaattttgttttctaaatacc

Exon 14 +      48590      48704   0   Internal    115    89        Good
taggtgttgatgtaccaaatcaaggtagtaaacaatccaagatgcagttggaggccatcc
tgccctgccctatgctctgtgaactgacctagctaggccttgttcctctatctgtgaatg
cgtgactcatcgatatgggcgtttgtgttgggcccataccaaccttgtttagtcccacag
TGTTTTGTTCGCCCCACGGAGGCCAAGAAAGCCGCAGATGAGGCCAAGATGAGATTTGCC
CACATAGATGGAGATCATCTGACACTGCTGAACGTCTACCATGCTTTTAAACAAA
gtaagtgtaaatttgattggagacactcttgtctaaatgtcacttgcagtgtataagatg
tttctttgtcccactttgatttattatccgtgacaacttatattagaaacccagaggtac
ttttgaaaaactcctgacgagcatttaaaatagaaattgccaatctttttcaaagttgtt

Exon 15 +      52701      52891   1   Internal    191    99   Excellent
tcacactacagatctttgagaaagttggtaacattgcagttcatttaaagaaaatgttgt
gggtaaatctcctttctggtttatttagcttattctttataacaatttttttaattagag
aacattcctgtgtgggtgattcatggtgccttcttttctccccgccttctacctttttag
ATCATGAATCGGTTCAGTGGTGTTATGACAACTTCATTAACTACAGGTCCCTGATGTCCG
CAGACAATGTACGCCAGCAGCTATCTCGAATTATGGACAGATTTAATTTGCCTCGTCGAA
GTACTGACTTTACAAGCAGGGACTATTATATTAATATAAGAAAAGCTTTGGTTACTGGGT
ATTTTATGCAG
gtatgtagataatatgggaatgaataactaagtattcatatgacactgatttctattaac
agtcctttgaatccactcaaaagcaaaagtgagtttgtgcatgctcataaaaatttatct
taaatgttggtacatccagtttctttgagtgaattaatatactaagaaattttaagtatt

Exon 16 +      55985      56154   0   Internal    170    67    Marginal
gttggatttggcccacaggcagcagtttgcttatctctgcttttatcagacagtgataaa
taagtatagccatagaatgaaaagtaaaagggaggcctgcctcttcctaattatgtaggt
agctttacaactagcaagtcagaagcattgtattaataatatactgggttttggtttcag
GTGGCACATTTAGAACGAACAGGGCATTACTTAACTGTGAAAGATAACCAGGTGGTTCAG
TTGCATCCCTCTACTGTTCTTGACCACAAACCTGAATGGGTGCTTTATAATGAGTTTGTT
CTAACAACAAAGAATTACATCCGGACATGTACAGATATCAAGCCAGAATG
gtaagtacaccttttgttctaacagttttttgttagtactttgctcaaaatggaacctga
ctgttgctagagtcatggccttgcattcactcattgagaatttatatttcagtgtgtagg
tatgagggaattgactggatggtgtgattaatctttcacacccttcctttgttaagtgga

Exon 17 +      57714      57831   2   Terminal    118    91   Excellent
acttaacacatttctaaaagtgctatttgtaaggattagttatttgtatttttctgagac
ttgaattcatagatttgccttggttcatcagtatattaatgaataatgcctatcctatta
acaactccagtacttcaattaaatgttaatttggaaatttttctgcccacttctaaacag
GTTGGTGAAAATTGCCCCTCAATATTATGACATGAGCAATTTCCCACAGTGTGAAGCAAA
GAGACAGTTGGACCGCATCATTGCCAAACTTCAATCCAAGGAATATTCACAGTACTGA
attcagtgcttagaactgaagttattgagaggacagctttaaaagatgaatgaactcaaa
agttcgagttgtgctcttcacgttggttcgataatggcctttatttgaaagctttttaat
ttttctttacagtaaatattccattctgatttcataaattaaacatttatgcctcccttt

--------------------------------------------------------------------------------