--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (68682 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1652       1815   1   Internal    164    64    Marginal
cggagccgcgctcgctgcaggcggcctcgagcgctctctcgttgatgccgttttggaggt
gaccggcgcggcggccgctctatggtggggccgcgttagtggctgcggctccgcgggact
ccagggcgcggctgcgaggtggcggggcgccccgcctgcagaaccctgcttgcagctcag
GTTTCGGGGTGCTTGAGGAGGCCGCCACGGCAGCGCGGGAGCGGAAGATGTTGGAGCTGA
GGCACCGGGGAAGCTGCCCCGGCCCCAGGGAAGCGGTGTCGCCGCCACACCGCGAGGGAG
AGGCGGCCGGCGGCGACCACGAAACCGAGAGCACCAGCGACAAA
gtaagtggagccgagagaggcggacgccgcgccctggctgggtcctggttggaagcggga
cacttgagagcaagggtggggcccgtccagcgtcaggtgaggctgcacgctgccggtgca
ccttcctccctgcctggcactgcttcctccttctccagagggggtcgggacccgggatcc

Exon  2 +       1974       2146   1   Terminal    173    46    Marginal
aaccgagagcaccagcgacaaagtaagtggagccgagagaggcggacgccgcgccctggc
tgggtcctggttggaagcgggacacttgagagcaagggtggggcccgtccagcgtcaggt
gaggctgcacgctgccggtgcaccttcctccctgcctggcactgcttcctccttctccag
AGGGGGTCGGGACCCGGGATCCCAGTGGCGGTGAGGTTCCCAGGATGACCGCGGCCGCTG
CCCGGGAGAAATGGGCCACTCAACCCGGCTTACAGTTTAGCTTCATCCTCTTCCGGTCCC
TTCTTCAGGATCTGGGGCCGACGCTGGAATCAGGAGGGAACCTGTCCTCCTAG
gggctgcagtgcagttagtagctgccacctcacctctcttttcagtagagggaacaaagt
tagtaaggactagagacgtgccaccgtcggctgtatcatttcatcggatcctgacgcggg
aggcttggcttctcgcgctgccccatatgcacttacattttctccatcctttttcagtat

Exon  3 +       6420       6500   1   Internal     81   100   Excellent
agagaaccttcagagaaggccaggttgcatcaatgcagattttctctacagacacaaatc
tacctcacaaaagacagctttgcagggctgtttgtttgcaggccctctgaacagccatct
caaaatatgtcaaagaagtataatttggggtgaaatattctgatttccttcacttgctag
ACCCTGAAGTGGGAGAAAAGAGGGTGCACATTGAGGCTGTGGCCAGTCAAGGGGAGCACA
CGTGGAATAGTGTGCTTTCAG
gtaagatccctgtgtgtttgtgcatggggctgctacttagggattttggtttgtgaagtt
gaggagaaaacaatccagagatcagttaacgtctctcctccatttgagatgtgtgcagct
tctttcataaatacattattattttcaaataaacttttaattttggaacaactttgattt

Exon  4 +       8818       8928   0   Terminal    111    75        Good
actaataaaagagtgaatctaaaggcatggtaatgtaatagtaagctatgtgcgggttag
gaatggtagttaacttgagatttctaaagaatatctgagggttaccatgtgaattttcac
ttagtgtttatgatctttaaacagttcattttcttattattttgagagatactaccatag
AATGTCATCAACTACATCAAGCTTTGGATGTGTACCACAGTGGGTTTTTTTGATGCTGTC
ATCCTAAGGAAGAAGCTGAGGCATAACATAGAATTTAAGGACAATACTTGA
gccaaatttaaagactttacttgagccaaagtgagtacactgcctgggacatacttccaa
gttgcctgggggtgtgccttggttggcctttgttataagcaagtttttaaaggcaaaaag
gaacagggaatgggctggtacaaagttgtttgacaggaattctcattgccttacagagat

Exon  5 +      22540      22667   0   Internal    128    88        Good
atagtcaaactttcctaacaaagaagtatagcagtgctaagattttcaagataaatagta
gtttctttgtttcagattatgtcactgagatttgacacactgagcaataaatgaatgtat
tggccagcctgtgcttttttaaacgtgattttgcaaagtaatttgtctttttaattttag
GAAACAGATATTGATGACAGATATGGAGATTTGGATTCCAGAACAGATTCTGATATTCCG
GAAATTCCACCATCCTCAGATAGAACCCCTGAGATTCTCAAAAAAGCTCTATCTGGTTTA
TCTTCAAG
gtatgattggatgaagatgagtatatcttagtgcacaagataggctttgaggttatcctt
gtccatgtaataaatttggctttttgtaagttttccagccatggtattaggtggtcaaaa
aggccacctaatatccgaggtatagttctatgtatttaatgtgtatccacccttaaaacc

Exon  6 +      27726      27822   0   Internal     97   100   Excellent
aatttatctcccagtgtgtgaatgaatgctgtttgttttttgtttttgttgtttgttata
taaagtgaagtagtagaatcttatagttaaggaaaattcataaatctggcaaatcaatac
tgaaaccacacaaaaaaccttaagaacacgttaaatactaactttacattttctttgtag
GTGGAAAAACTGGTGGATACGTGGAATTCTCACTCTAACTATGATCTCGTTGTTTTTCCT
GATCATCTATATGGGATCCTTCATGCTGATGCTTCTT
gtaagtttttgacttttccctgagtgtctcttgctttgtttttcaacatttatataggat
tgaagtaatttgagcatatcataaaaaagaagctaattcaacactcagtcacagaatatt
tagttcctttaagtgtcttttatttcatgatatgatctaacttaatcttttctgtttgca

Exon  7 +      37691      37830   2   Internal    140    69    Marginal
tcaataaatttgaaattaagtttaaaacaggaaaatagcattttggtaaaatatatcttg
aattggtcttctgaactttgttttgatctttgtgtcatcagaatgtagaaaataattttg
ttgagtttgaggggaaggaaagcttcaaatatagaaaagctaattgtttttaaattatag
GTACTTTCTATTGTGTGTAAACTACTTTTTCTATGGAGAGACTGTAGCTGATTATTTTGC
TACATTTGTTCAAAGAGAAGAACAACTTCAGTTCCTCATTCGCTACCATAGATTTATATC
ATTTGCCCTCTATCTGGCAG
gtaagttaaggaatattctgtattgatatatagttaacatattttccatgtttattttta
tttctgttattttaattagtaattttttggttaaattttattccagcctctctttttcat
tgtttcttgtgtataaagctatttctttcatcatgttcttaaatagcaattactccctta

Exon  8 +      50243      50286   2   Internal     44    94   Excellent
taaccctttgtaccaaattgtacaacgagcacatgttttttgttcttgaacaggtttctg
catgtttgtactgagtttggtgaagaaacattatcgtctgcagttttatatggtgtgtat
taactattattccttagtcattatctgtgataaaaacccttaacttttttttttctgtag
TGAGAAGATACAGTCGAATCTGCTAGCTGTTGTTTTGCATGAAT
gtgagggatacttggatttcagatgaccattagatataaactattaaagttgagaagttt
gtgaggattttaaaattttaactgttttcaaagtttactaaaaactttttctttgaatat
tttcaaatggtgtaaaattaaagtttttgggttccttaaatttgtagaaatttgaagaat

Exon  9 +      55875      55912   1   Terminal     38    66    Marginal
gatcttggcggaaggggaagcaggcacatcttatatggtcagagcaggaggaagagggag
agtgaggaggtgccacagacttttcaacaaccagatatcatgagaactcatgggacagca
atagggggatggtgcttaaccattagaaaccccctccctgacccagtcacttcccaccag
GCCCCACCTCCGACACTGAGGATTACAAGTGGACGTGA
catttgggtggagacacagatccaaaccatatcagaagccttcaaaaaggctgttatagc
tgtggaagaatattagcaactgattttgaacacagccttctagtgaatttatcaggctgg
attaattgtataatatacttagataattgaacagttaacccctaaatcgatatgatatgc

Exon 10 +      59135      59275   0   Internal    141    96   Excellent
ttactaggataattatgaccatttaactttgaaaatacatagcaaaatattaagacaaag
aaattctggcattctatctctggcctttctgatgtataacttaaaagatatatgtttagt
caatgtgttatgaacttttgctttgttttttgttttgttttgttttgtttttaatatcag
GCTGCCTATGTGTTATCCAAATACCAGTACTTTGTCTGCCCAGTGGAATACCGAAGTGAT
GTAAACTCCTTCGTGACAGAATGTGAGCCCTCAGAACTTTTCCAGCTTCAGACTTACTCA
CTTCCACCCTTTCTAAAGGCA
gtcttgagacaggtacagtaaaagttcaagataaacatggttagagatcttccactctga
agattaagcttcctttattatttatttatttatttaattaatttattgttgttttgagac
agagtttccctctgttgcccaggctggagtgtagtggcgtaatctcaacttactgcaacc

Exon 11 +      59916      60074   0    Initial    159    88        Good
attctttgatataccagtggttttagtgttagcttaaatcaaatggatgagaacgggtta
caaatcaaatggatcaaatggtttagaatgtgtttctcatatcactgacatcagttgaca
caatttaaaacttaaaattcaccagtttaccgagtccttgatttttagaggacatttatt
ATGGACAGAAAGTTGCTGCTTCTACAAATCAGTTTTCCTTCCAAATACAGTGCCTTCCTT
GAAAGGTATCTTGGAGGCCTTACACTAGAGGATGTTGACATGCCCTCCAGTGGAACCCTC
CTGATCTGTGTCATCAGGTCTGGTGAGTGGCTGGTTAAA
gtgaggaatcaaataatagcatgtatgtctgtatctttgtgtgcacacatgtacagcttt
gtatctgaatcattttacataaaatccataatttttgaggagtagcttaacaaattattt
ctctctgagtgctcagtacatggtttccaagaactttttcaatgtccaagccatctgtta

Exon 12 +      61321      61442   0   Internal    122   100   Excellent
ggatggtacagaaggcttaaatagacttttcttccttgatccttaaagtttgaaaaatta
acaaaaatgtggtgcgtgctttgacttactatttacacaatggttcttagatcaggtggt
atgctcaaatacaatttcagtgaaattagcccctctcctccccttctttctcctctttag
GAAAGAGTGAGCTTGTACCCTTTCCAGATCCACAGCATTGCACTGTCAACCTTTGCATCT
TTAATTGGCCCATTTGGAGGCTTCTTTGCTAGTGGATTCAAAAGAGCCTTCAAAATCAAG
GT
gtgtgtttagattctttgttatattattagagaatataattagagaatgtaacctagttg
gaatttggtccgctcatgatctacattaagcccctaggccacaacttttatatcctattt
gtttcgaccccacagaaatgctgccacgttgatctgaatgtattctttctttttaggttt

Exon 13 +      63824      63891   1   Terminal     68    63    Marginal
tttttagatgatttctttgagttctcatttccatcaacattagtttgagtaagttaactt
tttccgtcaatggtaatctacaatattaaagtgaatggtggcccctggaattagagtctt
gagcaagatggttaacttgtaattgttttacctacatttgaacaacttaaaaaaagatag
TATTTGTCATGGTCCTGGACCACATTGAAGACCCAATTAATGTGGATGGTATAGGATTTG
AAACTTGA
ggagatttgatttctcaactgtgggcattgcaatgatcatgaatactaagagttaaaaag
ggagataacgaaatgcatccagtctaccaattattacttgagtgcctgccatattgtaga
atgttctagggacaaatatggcagagaacaaaacaaaccaaatctctgcccccatagcta

Exon 14 +      66854      66983   2   Terminal    130    84        Good
tgctgtaacccttgacactaacattgcacattaaagtgagctattatcaagagctatttt
aattctgtaaagattcctactctacacttaaaggaatggtttgttttaaattggaggtat
gtgcttcacttatccctattaaaataacacgaacttgtcttctttgccttttatcattag
GGGCCCAAATCCCAGCAAAGTGCTACAGCAGTTGTTGGTGCTTCAACCTGAACAGCAGTT
AAATATATATAAAACCCTGAAGACTCATCTCATTGAGAAAGGAATCCTACAACCCACCTT
GAAGGTATAA
ctggatccagagagggaaggactgacaagaaggaattattcagaaaaacactgacagatg
ttttataaattgtacagaaaaatagttaaaaatgcaataggttgaagttttggagatatg
tttctctctgaaattactgtgaatatttaacaaacacttacttgatctatgttatgaaat

Exon 15 +      68167      68236   0    Initial     70    45    Marginal
cgcaagaaggaagatctgcctggagacctgatcccagtccagctttttgaccataggtca
tctttgtccccttgctcctttgcatcatgtcataaaatttgaggatatcagctgattatt
ttttcttccaagaatgaaaatcaagcagaattgattcctacacgaaaaaaaagcacacga
ATGCCAAACCTTTCCTTTGGTGGACTGGACACTAACCAGATGAGAGTAAATTTCTTATCC
GTGGACGTAT
gtaagctactgctgctgtgtgctctccacagccatatttattgtattaaacaatcagcac
taaaccttcaaaaattgcccagtgttcctagttaaatgttcagaggggagaaatagatat
attttaaataatgttttgctaatgaaaagagtaaatatttttgtttaaatcagcaaaaac

--------------------------------------------------------------------------------