--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (53624 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5600       5767   0    Initial    168    95   Excellent
tgtagaaacactaggaaattgtgaattaatacaggacagccatgaacacagtgactaata
tggaaaacaagcagggaagaattaatttgctgggaaggcggaggaaattaacgtactcaa
ctttgttaaatctatgttttggttttcacagcaaaaagtttctacggactttaaattaaa
ATGGAAAAATATGAAAACCTGGGTTTGGTTGGAGAAGGGAGTTATGGAATGGTGATGAAG
TGTAGGAATAAAGATACTGGAAGAATTGTGGCCATAAAGAAGTTCTTAGAAAGTGACGAT
GACAAAATGGTTAAAAAGATTGCAATGCGAGAAATCAAGTTACTAAAG
gtgagtaaatgcatatattgaatcaaaaaatatgagtataagtttcttttttggcaataa
gaagaaatacaatgattagatatgcaaattcatttatctggtgaatgtaaacctgatttt
aaaagtgtttgttccttctctctatatctttctgtgtatttatcaatcatctatctatag

Exon  2 +      14450      14560   0    Initial    111    73        Good
attatgtataatatcatactcttttataacttttatttttttcttggcaacgcttctttt
acattgtaaaatgtctgttttaagggaaggcagggtagaagtttgtgtttttttttaact
tttaagttcaggggtacatgtgcaggatgtacaggtttgttacataggtaaacatgtgtc
ATGGGGTTTGATGACTTGGAGCTCTTTCCAAATGGACTAGACTACCAACTAGTTCAAAAG
TACTTGTTTCAGATTATTAATAATGGAATTGGATTTTGTCGCAGTCACGAT
gtaagtcttgggtttaaacaattatttgtcagtcatttttcctggtcctctcccttctcc
caccctttgccctccggtaggccccagtgtgtgttgttcccctctatgtgcactcatcat
ttagctcccacttataagtgacaacatgtggtatttggttttctgttcctattagtttgc

Exon  3 +      17139      17284   0   Internal    146    97   Excellent
caattgtagtttaaaaaccagaatatgcttttacaatttacactatgtatgcattttatt
tatatatttttcttacgctgagatctattttaaataattaattgctaataatttgatctt
agtttatataaactattttgcatttttaaataacagctattttgcattttttaataacag
CAACTTAGGCATGAAAACTTGGTGAATCTCTTGGAAGTGTGTAAGAAAAAAAAACGATGG
TACCTAGTCTTTGAATTTGTTGACCACACAATTCTTGATGACTTGGAGCTCTTTCCAAAT
GGACTAGACTACCAAGTAGTTCAAAA
gtatttgtttcagattattaatggaattggattttgtcacagtcacaatgtaagtattgg
gtttaaataatttgctttatcacatatttattcattaatcctttaatctgtcttattgat
ttatgcatttgaaaataagttgcagacatcagtatactttaacactaaatacttcatctg

Exon  4 +      25954      26066   2   Internal    113    54    Marginal
ttttttttttggattttgggatatttgcattataccattggagcatgccaaatctgagaa
tctgaaatctgaaatgctctggttggcatttcctttgagcatcacctcagtgctcaaaaa
gctttgggttttggagcatattaggatgccagattttacaccacattgcttttctttcag
GGCTGTTGATGTGTGGGCCATTGGTTGTCTGGTAACTGAAATGTTCATGGGGGAACCCCT
ATTTCCTGGAGATTCTGATATTGATCAGCTATATCATATTATGATGTGTTTAG
gtaaggttacacatctgcattttaaattttagagatttttctgcatatttgtttgtgcct
gtgtgtttgtgattttttaagctgttgcattaaagattatatatgttttaagtgaaggta
gggagcatataggaaaactctgtgtgtgtgtgtgtgtgtgtgtgttttgagatggagttt

Exon  5 +      31757      31829   0    Initial     73    43    Marginal
ttgatttctatgttgctaccaactgtgtgatgccatcatcttagatgctgatgtagttac
aaaagtgccatctcctattgctgccaaactcataccacaccaagtcctttgatactgctg
acactgctgatgtgttggagaccttgatatgccaaacctgtgggtgccagagttgctggc
ATGGTCTTCTGTGCTGCTCAAGCTGCTGGCAACAGTGCAGCTGACGAAACAAAGAATAGT
GAGATGAGTGGCA
gtaacacgtagcttaataaaaggtagctaggttttcctatttgcttttgtactcaattag
ttgtgatatgttgtttttgtggaagtatatgaagaaactctggcctcacgtaagtagata
attgtgggtattctttgattctataccaaaactctgataccatagcaaaacttgacagtg

Exon  6 +      33376      33511   2   Internal    136   100   Excellent
gatccccaaagatctacacaccaccctttccaaactgctgatctaggccaggatttttct
catttttaataacatagactagtttaacattcaatttttaaaaaataaatatcttgaaag
tcaatttttttgtaggtttatccatgtcttacaattttattttattatatttttatgtag
GTTTTCCCAAGAACTACAGTTAAAAGTACAGAAAGATGCCAGAAATGTTTCTTTATCTAA
AAAATCCCAAAACAGAAAGAAGGAAAAAGAAAAAGATGATTCCTTAGTTGAAGAAAGAAA
AACACTTGTGGTACAG
gtaaatgttcatgtttcacattttagatttaatatacttatttttttaaattttttgaga
aaaaatatgattttgaaaaaagttttctgagcagtgagcaaattgttaacttttagttta
gttgtaaaaatgtatcttctcagtagatattacctgtttagaaaacttaacatatcatgt

Exon  7 +      34352      34653   0   Internal    302    73        Good
aataactatctgaataagaatctggctttaattttaatcccctaggaagaataaagaaaa
cagtttcaaaaaggtgatacttatgatattctgctctagttgacaagtactttataagaa
gaggtaaattttcattctcttcagatcattaaccttattaatatttttgttaatgatcag
GATACCAATGCTGATCCCAAAATTAAGGATTATAAACTATTTAAAATAAAAGGCTCAAAA
ATTGATGGAGAAAAAGCTGAAAAAGGCAATAGAGCTTCAAATGCCAGCTGTCTCCATGAC
AGTAGGACAAGCCACAACAAAATAGTGCCTTCAACAAGCCTCAAAGACTGCAGCAATGTC
AGCGTGGACCACACAAGGAATCCAAGCGTGGCAATTCCCCCACTTACACACAATCTTTCT
GCAGTTGCTCCCAGCATTAATTCTGGAATGGGGACTGAGACTATACCAATTCAGGGTTAC
AG
gtatgaattagtaaaataagatcaaaaaagtgtttaaggacatatttgcaaattgcaagg
gtttgtcaattcatccacattgtttttattctcagaattctggatgctattcattcttgt
caggtagctgtttcaaaagactttttggctgtgtgatgaagattattagcatttgatcaa

Exon  8 +      35248      35380   2   Internal    133    72        Good
catgagggtagtgttaaagaatagaatgtttcaccagatttatgtgcattgtatatttga
gaatagacattacactctggttaaactgcttgttagttggtgctgtgtcatttagttttg
tgcttgaaaaaataattattgctggttctaacttaaaaacatttttttttgtcgttacag
AGTGGATGAGAAAACTAAGAAGTGTTCTATTCCATTTGTTAAACCGAACAGACATTCCCC
ATCAGGCATTTATAACATTAATGTGACCACATTAGTAAGTAAGCAGTTCTCAGTAGTAGA
AGAGCAAACACCA
gtcagctctagacttttattaaaattaaatatgatagtgaagtattgagaattttgtttg
gatacacataaagtgaaaccttaattgtgcatatattatcccaacccatcatagtcataa
acgtgaaattctgaaagtttaagttttatgagtctaaaaactccttccttcctttcttcc

Exon  9 +      47851      47952   2   Internal    102    79        Good
tttcctttccagttttcttttgtttttgaatagtttcagtattttttcggcaatatcttt
ttatattttttttagtgattgctcgaggaattacaatatacatcactaatttttcgtagt
ctacattgtaccccttgaaataaaaagtacgaattgcccatccatttctccatcatccag
GAAAGACGTTGGTTTTGAGGTTGACATACCTATAAAGGACAGTAACTACCATGGCTTCCA
CCGCTTTGGCAAAACCTCAGATGTGTGGTCTTCTGGCCAAAT
gtctgcaatttcatattgttggagcctttattgtatccctgggggttgcagctgtctgta
agattgctgtggctgaaccaagaaagaagacatatgcagatttctacagaaattatgatt
ccgtgaaagatttggaggagatggggaaggctggtatctttcagaatacaaagtgatttt

--------------------------------------------------------------------------------