--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (33245 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7253       7369   0   Internal    117    96   Excellent
cccaaccttactagattatagattattttacaatttttacatttgtcaaaatttatattt
tttttttgcagataatcatttcatctccatataatgatcatttatgttttcctgtctttc
atgtatgcaaattagttcccttaactaatggcattaaatttgttgatttttctttcatag
AAGAGCTGGATATTCTTTCGCCCAGTTATGGCAGACAAGTTAACGAGAATTGCTATTGTC
AACCATGACAAATGTAAACCTAAGAAATGTCGACAGGAATGCAAAAAGAGTTGTCCT
gtagttcgaatgggtaagctgttctgtggatcatttaagtataaaagaaaaccatgaaag
aaatcaactggtttgataattctttacggacattaacataaactttgtgttcaccattag
tttcataaaactgtgaagacaagaaaagtagtttgttctaaatttcttttattgctttgt

Exon  2 +      12970      13107   0   Internal    138   100   Excellent
tgttttctttctttgctgctatagggaaatgagacttttattaattatgttcgcctccaa
ccttaagttaaaagccacaagtgttctatttgcatatataatctatttcctgtagcattc
atcctctttgtcattgtattattaaattcacatgattctgtattttttttttttttttag
GATCCTCCTGACTGGCAGGAGATTTTGACTTATTTCCGTGGATCTGAATTACAAAATTAC
TTTACAAAGATTCTAGAAGATGACCTAAAAGCCATCATCAAACCTCAATATGTAGACCAG
ATTCCTAAGGCTGCAAAG
gtcggtttttgatagagggaacttaacggatattagtagaagtataaaagatatatcaaa
ataaacttgttttactttgtgattctttttaatattgaaagaaaatagtaactgtttttg
gtatattgtggcaggggacagtgggatctattttggaccgaaaagatgaaacaaagacac

Exon  3 +      13242      13311   0   Internal     70   100   Excellent
catcatcaaacctcaatatgtagaccagattcctaaggctgcaaaggtcggtttttgata
gagggaacttaacggatattagtagaagtataaaagatatatcaaaataaacttgtttta
ctttgtgattctttttaatattgaaagaaaatagtaactgtttttggtatattgtggcag
GGGACAGTGGGATCTATTTTGGACCGAAAAGATGAAACAAAGACACAGGCAATTGTATGT
CAGCAGCTTG
gtaagtgtttattttttgtttgtgtgaatatatatttatttattttttgagacggagttt
cgctcttgttgcccaggctggggtgcaatgatgcaacctctgcttaccacaacctctgcc
tcccgggttcaagcgatactcctgcctcagcctcccaagtagctgggattacaggcatgt

Exon  4 +      13746      13935   2   Terminal    190    59    Marginal
actcccacctgcctcagcctcccaaagtgctaggattacaggcgtgagccactgcgcccg
gccattttgtgtatatatttcaataggccctgaacttaagtgatgaaagtacacatcttt
atgtggattactgaaaatctccagtaattgttatatttaaacaattttcaactgaaatag
CATTCAAACTTCAAATGATGACATGCAGTATACTTTTTACCTGGAAGAGGTGAAATACAT
TGAGCACAATGCCTCTATGTTCTTTGTAGATTTAACCCACCTAAAAGAACGAAATGTTGA
AGATCTTTCAGGAGGAGAGTTGCAGAGATTTGCTTGTGCTGTCGTTTGCATACAGAAAGC
TGATATGTAG
gttactttacaatttttgtttatcttcatccgtattgtagagttttcagttgtgatgctg
ctaatagaggaatggttttgagagaaattaatagaaatagtatctaagttcctaatttcg
aggtaagatgttgaagcagttgtgtatccactactcattttccctgttatattcacaggg

Exon  5 +      15106      15195   2   Internal     90   100   Excellent
tctacttctgaacagaatacagaaatttttaccattacaagtagactcttcattactatt
ggagatttgtgttgtggttaactcaaaagctcttgatactacagtgctttaaaatagtat
gtaaggtagaatgtcttgtctttcaaacttatatttgctttttttttttttttttcatag
TTTCATGTTTGATGAGCCTTCTAGTTACCTAGATGTCAAGCAGCGTTTAAAGGCTGCTAT
TACTATACGATCTCTAATAAATCCAGATAG
gtaagtagagatctggcatattactgtgttgttttgtttggagatttttacagatttcta
aggattaaacactgggactgtcaatgtgatgtacatattttttatcttggttgtttatag
ctgccacctaaatttacctttctttacctagaacagaggttctcaatgcaagattcattt

Exon  6 +      20160      20271   2   Internal    112    68    Marginal
gttcaggaaaacatttttaaatatgagcattgataatgagccttactaaaaatgttttat
ggcttttgcttcttatgtctttatgcttaaattttattagatgtatctctttttctgaaa
tttccaactattaaaaatagttatgtaagagttttaactaaaatctggtttgattttcag
ATATATCATTGTGGTGGAACATGATCTAAGTGTATTAGACTATCTCTCCGACTTCATCTG
CTGTTTATATGGTGTACCAAGCGCCTATGGAGTTGTCACTATGCCTTTTAGT
gtaagagaaggtaacttgaaaaacttttttcacatatgctgtattctcttctactctaat
gcttataaactacattattgatattaagtagttttacattggtctgatatcatccaaaac
tctagttccttggaatttaatcactgagcatataaggttatatatatcagttgttataca

Exon  7 +      22799      23001   1   Internal    203   100   Excellent
tgaattatttaaacttacattaaatatatatagttttttaagttacttctttatatgcag
accaacatgttagcaaaaatccacagaaatttaaagtatatagtctatagattgctccca
agagagcttaggattttggctctaatgatttctcccggttgacaattttcttcccaacag
GCATAAACATTTTTTTGGATGGCTATGTTCCAACAGAAAACTTGAGATTCAGAGATGCAT
CACTTGTTTTTAAAGTGGCTGAGACAGCAAATGAAGAAGAAGTTAAAAAGATGTGTATGT
ATAAATATCCAGGAATGAAGAAAAAAATGGGAGAATTTGAGCTAGCAATTGTAGCTGGAG
AGTTTACAGATTCTGAAATTATG
gtgatgctgggggaaaatggtaagttttctgttttgtgataagtaaaaatcttcctgttt
atctagtaaattagttttaactgttttgtggaaaaatttgaatcatatgttatagggcta
gaagcagagttttatttaaacccacaaatttcttagtgtactttcacatttttttggcat

Exon  8 +      25888      25998   0   Internal    111    99   Excellent
acatgatgggttttgaatagaaaatctcaaaacatgtcatagatggtggatacacattga
tatctgttggtggcaaattgatatacttttattctgaagcttaactttgtcaagattcat
aaatagaagagttctatagtgaaagtttatcatttaaatacttttttatattaaaaacag
GGAAGTGTTCGCCAGTTACTACATGAAAAGATAAGAGATGCTTATACTCACCCACAATTT
GTGACCGATGTAATGAAGCCTCTGCAAATTGAAAACATCATTGATCAAGAG
gtactttaacataattttttttatttttttattattttgaattttggatgcctttacatg
gtttgctaaactcctccaattaggtgcagacattatctggtggtgaactacagcgagtag
ctttagccctttgcttgggcaaacctgctgatgtctatttaattgatgaaccatctgcat

Exon  9 +      26082      26224   0   Internal    143    77        Good
gttactacatgaaaagataagagatgcttatactcacccacaatttgtgaccgatgtaat
gaagcctctgcaaattgaaaacatcattgatcaagaggtactttaacataatttttttta
tttttttattattttgaattttggatgcctttacatggtttgctaaactcctccaattag
GTGCAGACATTATCTGGTGGTGAACTACAGCGAGTAGCTTTAGCCCTTTGCTTGGGCAAA
CCTGCTGATGTCTATTTAATTGATGAACCATCTGCATATTTGGATTCTGAGCAAAGACTG
ATGGCAGCTCGAGTTGTCAAACG
gtaaatatcttgctcctagccatattttgattatgtatactgtcctacaagtgtgcttaa
tataacagtcgaatgttttatgatagaaagctataagatttcaaaatcattgtgttttag
tttcatactccatgcaaaaaagacagcctttgttgtggaacatgacttcatcatggccac

Exon 10 +      26345      26467   2   Internal    123   100   Excellent
tgaaccatctgcatatttggattctgagcaaagactgatggcagctcgagttgtcaaacg
gtaaatatcttgctcctagccatattttgattatgtatactgtcctacaagtgtgcttaa
tataacagtcgaatgttttatgatagaaagctataagatttcaaaatcattgtgttttag
TTTCATACTCCATGCAAAAAAGACAGCCTTTGTTGTGGAACATGACTTCATCATGGCCAC
CTATCTAGCGGATCGCGTCATCGTTTTTGATGGTGTTCCATCTAAGAACACAGTTGCAAA
CAG
gtaaaattactttttaatatgttcaaagtaattcattttaaattttccagtaaatagtaa
agtcactcactttaatttttaaaaaatgaaagctagaaattctagacttgattctgtgac
tcctgagatcattggtattggggactggatgggaccatgtggaagagtagtgtttaggct

Exon 11 +      26960      27014   2   Terminal     55    49    Marginal
tattgctttcatacatgatagaaaaagaaaacaagattaaagaggttacatgatttgtcc
aacttatgctgacagtgattgagctcacagtggatcccaaatatctggtattaatctata
gcagagttaaaataaatggttttacttttttcgttttttcttctcatttttccttgttag
CCTGATTAAGAGCACTTGCAATATAGAGAAGCCTAACATTCAGATCAAGTTATGA
gaaattcattttacctttagtgctaaagcctatattattagattgaactaaatgaaatta
ctggtgttcagttttcacctataaaaccagcagtttcatgtggtttcagcatgttttctg
gtattggagagcaaggaatggagttgccattttaataattcatctaagaaataaaagtat

Exon 12 +      30393      30440   0   Terminal     48    67    Marginal
aggtagttatctttcctttgagcagtggacccaggaatatccagaaacagatggtatgtg
cagaacaggttgtacaggcactgttttaagcacagctaagtaataccatgagtgaaagtc
tacttttacctatagtagaatcgtgttgctgatttttgtggcttctgttttcttttttag
GATGTAGAACAAAAGAAGAGTGGAAACTACTTTTTCTTGGATGATTAG
actgactctgagaatattgataagccatttattaaaaggagtatttactagaattttttg
tcatataaaacttgaatcaggattttatgccccacatactctggaacttgaagtataata
tacttaatataacataaaaagccagttgggttctaaattgtagttgaaacacagaaaatg

--------------------------------------------------------------------------------