Gene ZNF148 Variant 1
DNA : 143.17 KbNT_005612
mRNA : 3032 bp NM_021964
CDS : 2385 bp NP_068799
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  150 bp
tgcgccagacgagggcgggcgccgcggagcgcttcccgtgtgcggggcttcccacaatgc
accgggccggcagtggcggcgaccgcggcggcgctctagctgcggcatgtctgcgtctct
actgctctgggaggaggaagagaaggaggaagaggaggaggaggaggagggggaggaaga
GGAGAAAGGCGCAGGGGTGGGAGCTGTTGCCGAAGCTGCCACAGCAAAAGTTCTCCCCCC
TCCCCCCTTCCCCTCCTCTCAAGGCCCCTAGAAAGGTTGGAGCTGCCGCCGCCTGCAGTC
GGTGACCGCGCGACTCGGCGCCCGCCCGCG
gtaaagcgctcggcctggcaggcccgggcccgggggagggcgggggagggggagggggcg
gcgcgcggggggagcgcgcggcggtaacggcctgaccccggggggagcgagccgtggcga
ggctgggggtggccagggggccagccgaggccgagggaaacgctggggctggctggggga
EXON 2  81 bp
tcattgcactcagactaagtgttagttgttactaattttatttactctaacagtatctac
catggaaagaattttggtagacttaggacacttaaatgtaacagttttacctgacttctt
taagactatgtttaatcctgattcttttgggggttaacctgtatttgtgtacttttgtag
GATAGAGGGAGGAATCAGCAGCTTGGAAATTCAAGCACGTGATCTGGCGGGATGGGCGTT
TGCCTAACGTATTTAATGGAG
gtaattcagcattctttgagtcaatctttaatttttacctgtaatggatgcccatgttac
tacacatacttacaataactgttgggtataagtgtgcatttatggccaatcccttttctt
tttatattcatataaataacatggtatcactattataaatattataaataatatgtagat
EXON 3  136 bp
ctattgtattttcccaatttcaaacataaaaacaagtcagtacattggtcattcagtcat
aacttactgtatttagaaagaattttcacttcagtattcataccaatttgcacatattat
atttgtatagtatcttttcctaccataaataatgtttgttgtgtgtgtgttttattgtag
GAATCGGATGGCATAAGTGATTAAGGTGGTATTGAGGATTTCTGAAGCCTATGAAAGGTA
GAAACTCAACCATGATTTCTTTTTCAACTCTACAGCATTCCTTTCCTTGAAGTCTTCGTT
TTTACCTTAGTCTCGG
gtaattttaatacttatttttcataatcttgaataaataagttttttcaaatatgaagtc
attgtgttcagctgctagaattttatactgaatttatataatagtttcttaaagttttgg
tatttatatttggaagaaactagtttttttcctgagaaaagaaatttaaatgatgaataa
EXON 4  349 bp
ttattctaccagcctttggaaaccgatattggtattataattttaaaattggaggcagtt
ccaaagtacatcaataaaatctttgtatttgaatgttcaaattcttaatttgaaaattta
aaatgaagtagtcatataaaactaatttactatgttttgttgccaaacttggttttctag
GCAGTTATACTTAAGCATGAACATTGACGACAAACTGGAAGGATTGTTTCTTAAATGTGG
CGGCATAGACGAAATGCAGTCTTCCAGGACAATGGTTGTAATGGGTGGAGTGTCTGGCCA
GTCTACTGTGTCTGGAGAGCTACAGGATTCAGTACTTCAAGATCGAAGTATGCCTCACCA
GGAGATCCTTGCTGCAGATGAAGTGTTACAAGAAAGTGAAATGAGACAACAGGATATGAT
ATCACATGATGAACTCATGGTCCATGAGGAGACAGTGAAAAATGATGAAGAGCAGATGGA
AACACATGAAAGACTTCCTCAAGGACTACAGTATGCACTTAATGTCCCT
gtaagtaattcctttataagatattaaacttagaaacataattttttgttacgtaatact
gcaagtcatcgaagaaatttcagaaaatgtttcagggctaaatagtgttcttgaatagat
atactaaaatattgacataaatcatatttgaaaggcaaaattaagttcttgtattatatt
EXON 5  126 bp
tattacccactgcctattaatgaattctatagcactgtatatagttaggacacacacaca
tagatcatcattctggaagcacctgtatgtgggtttagcaaaggattaaacataaaatgg
ccttttgtcacaatgaactttttatttatgtctaaaattggcttttctttttttaaacag
ATAAGCGTAAAGCAGGAAATTACTTTTACTGATGTATCTGAGCAACTGATGAGAGACAAA
AAACAAATCAGAGAGCCAGTAGACTTACAGAAAAAGAAGAAGCGGAAACAACGTTCTCCC
GCAAAA
gtaagacaatgtattaaggtggtaatcacaacctcttaattccaactgttggttaattct
ataggcaagaacctggctggaccctaaggcagatgtagaagtcttgtgtggtttagtagg
agggggtgcgtgcctgcatggaggtggtgggccttgctttcaatttttctgcttctcttt
EXON 6  124 bp
ttgtactttcctacagttaatgataacattattctaatagtcttttcaagatcatttaag
aacaaaatatttcataatctgtggtgaccgttgtttgcattatcttttttttaaaattac
tatttaattacattttaaaaacttatttcttttgtttttgcctttttttttttgaactag
ATCCTTACAATAAATGAGGATGGATCACTTGGTTTGAAAACCCCTAAATCTCACGTTTGT
GAGCACTGCAATGCTGCCTTTAGAACGAACTATCACTTACAGAGACATGTCTTCATTCAT
ACAG
gtatttcttgaattaaaatgggcttgtggccattaaagttattatctttgttattttcat
cttcgtgtaactgtcattcattcctaagaccatagctaatctggcattccaaatcagaga
ttttgtaggccagaatgtcagaaggaaaccaggaaaaactcttaagtgagaaaacaatta
EXON 7  84 bp
ttaaatcctgggaaaaaaattgagaggacataaaattctgttaataacattaaaaatttg
tatggctattttgtaattttccaaaatttgggcatctaagatttttctttcctcagaaac
agtaactaaaaaccgttgttttattcagtaactaatttgtggatgtgaaattattttaag
GTGAAAAACCATTTCAATGTAGTCAATGTGACATGCGTTTCATACAGAAGTACCTGCTTC
AGAGACATGAGAAGATTCATACTG
gtgagtgttaaccacccttactaggttcattaaaatgattatttcaaatggagggaagaa
tttttaataagtggcagtgacttgctgccatttccattggtttagactataaatcacagg
ttatcttttttctcccttcaataaatcaatgttaactgttaagacttaactttaatgtcc
EXON 8  119 bp
tccttttctttccaatagcatatgctaatccttttcatttttataaagcaaaatatattt
gacaaatgaaattggaagttacaactttcaaaagccatttattttagagattcttatggc
aaagcaattcattattttacaatatttgttttgttttaaactttctatattatgtgctag
GTGAAAAACCATTTCGCTGTGATGAATGTGGTATGAGATTCATACAAAAATATCATATGG
AAAGGCATAAGAGAACTCATAGTGGAGAAAAACCTTACCAGTGTGAATACTGTTTACAG
gtaagagagatggcttgaaattcttctactgtaattaaattatacaataattataaatta
gattagaaaatattacaacttagagctatttaaggggccttctaactcttacagattaga
tttataatagaaaattggctcagtgaatttgtttggaattatgtatgttattgcattaat
EXON 9  1863 bp
aaggggccttctaactcttacagattagatttataatagaaaattggctcagtgaatttg
tttggaattatgtatgttattgcattaatatatctttatattaattgttttgtttcactt
tttcttttcttggttgaccaaaaccacaaacaacccactaccatcctctgaattcaacag
TATTTTTCCAGAACAGATCGTGTATTGAAACATAAACGTATGTGCCATGAAAATCATGAC
AAAAAACTAAATAGATGTGCCATCAAAGGTGGCCTTCTGACATCTGAGGAAGATTCTGGC
TTTTCTACATCACCAAAAGACAACTCACTGCCAAAAAAGAAAAGGCAGAAAACGGAGAAA
AAATCATCTGGAATGGACAAAGAGAGTGCTTTGGACAAATCTGACCTGAAAAAAGACAAA
AATGATTACTTGCCTCTTTATTCTTCAAGTACTAAAGTAAAAGATGAGTATATGGTTGCA
GAATATGCTGTTGAAATGCCACATTCGTCAGTTGGGGGCTCGCATTTAGAAGATGCGTCA
GGAGAAATACACCCACCTAAGTTAGTTCTCAAAAAAATTAATAGTAAGAGAAGTCTGAAA
CAGCCACTGGAGCAAAATCAAACAATTTCACCTTTATCCACATATGAAGAGAGCAAAGTT
TCAAAGTATGCTTTTGAACTTGTGGATAAACAGGCTTTACTGGACTCAGAAGGCAATGCT
GACATTGATCAGGTTGATAATTTGCAGGAGGGGCCCAGTAAACCTGTGCATAGTAGTACT
AATTATGATGATGCCATGCAGTTTTTGAAGAAGAAGCGGTATCTTCAAGCAGCAAGTAAC
AACAGCAGGGAATATGCGCTGAATGTGGGTACCATAGCTTCTCAGCCTTCTGTAACACAA
GCAGCTGTGGCAAGTGTCATTGATGAAAGTACCACGGCATCCATATTAGAGTCACAGGCA
CTGAATGTGGAGATTAAGAGTAATCATGACAAAAATGTTATTCCAGATGAGGTACTGCAG
ACTCTGTTGGATCATTATTCCCACAAAGCTAATGGACAGCATGAGATATCCTTCAGTGTT
GCAGATACTGAAGTGACTTCTAGCATATCAATAAATTCTTCAGAAGTACCAGAGGTCACC
CCGTCAGAGAATGTTGGATCAAGCTCCCAAGCATCCTCATCAGATAAAGCCAACATGTTG
CAGGAATACTCCAAGTTTCTGCAGCAGGCTTTGGACAGAACTAGCCAAAATGATGCCTAT
TTGAATAGCCCGAGCCTTAACTTTGTGACTGATAACCAGACCCTCCCAAATCAGCCAGCA
TTCTCTTCCATAGACAAGCAGGTCTATGCCACCATGCCCATCAATAGCTTTCGATCAGGA
ATGAATTCTCCACTAAGAACAACTCCAGATAAGTCCCACTTTGGACTAATAGTTGGTGAT
TCACAGCACTCATTTCCCTTTTCAGGTGATGAGACAAACCATGCTTCTGCCACATCAACA
CAGGACTTTCTGGATCAAGTGACTTCTCAGAAGAAAGCTGAGGCCCAGCCTGTCCACCAA
GCTTACCAAATGAGCTCCTTTGAACAGCCCTTCCGTGCTCCCTATCATGGATCAAGAGCT
GGAATAGCTACTCAATTTAGCACTGCCAATGGACAGGTGAACCTTCGGGGACCAGGGACA
AGTGCTGAATTTTCAGAATTTCCCTTGGTGAATGTAAATGATAATAGAGCTGGGATGACA
TCTTCACCTGATGCCACAACTGGCCAGACTTTTGGCTAAAAAAAAAAAAAAAGTGTAAAT
AATACTGGCACTTTAGAACAGATTAATCAAGAGTGGGGTTACTCTGTGTAAATGGAGTGC
TGTACAGATTTAAGAGCAATGCGTAATAACAAGTTAAGCTGATATGAATAGCAAGATAAT
CCAATAACTGCATTTCGTTTGGTTAGTCAGCATTCTTTGAACTGCCTTACATGTTGTCAC
CTTTATAGAAGCAATGCATTACTTGTTTTAGATCAGAAACTTGCTATTCCACCCACACCA
AGT
taaaaaggaaaaaaaaaagactttcgcacaattgtttcctaactgataacattgtacatt
cttaggagattagtaattgtgtgaaatttactcatactgtttctaagtttttcagcatag
tcattgcacttcagcagggaatctgagtatactttacagacagagtgaacttaaaagttt