Gene WDR6 Variant 3
DNA : 8.54 KbNT_022517
mRNA : 2078 bp NM_052826
CDS : 870 bp NP_439891
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
cgggatgcccctccgcgggccccgccaatgatgagctggattgcgtgggacgaagggtcg
tcattggacaaccgccgcgggcgccctggtctctgctacctgtagctgagggcgctgttg
atgggcagcgcggcgcgctgggaaggctcgttctcgcgagagttcagctcccttcttagc
CGTGGCTGCCTCAGCACCTCGAGGATCGACATGGACGCTCTCGAGGACTACGTTTGGCCG
CGGGCAACCTCGGAGCTTATACTCCTCCCAGTGACGGGTCTGGAGTGCGTGGGGGACCGG
CTGTTGGCGG
gtgaggcttggcttgaggcacgcctggtggaaagggggaaagaaacagcgcctcccaggg
gcggtgccacagggacaaaaggggtgccctgaggagaaggacgggcagcaggttgaggcc
gatcggaggtgggaagggagccccggagatggcggggacgagggccaacctgaagagggc
EXON 2  244 bp
caggcgtgagccaccgcacccggccgagaccaaggattttctaagattcaagctgcagga
ttgtgtgtcctgatgcattcataggctacatgccgagaagtttccctgatccccatctct
tccctgtgggtcatcagagttaggtacctagctctgacatggctctttgcctctatctag
GTGAGGGTCCCGATGTCCTGGTGTACAGCTTGGACTTTGGTGGGCATCTGCGGATGATAA
AGCGAGTGCAGAACCTGCTTGGCCACTATCTTATCCATGGCTTCCGGGTACGGCCAGAGC
CTAATGGAGACCTTGACTTGGAGGCCATGGTGGCTGTGTTTGGAAGCAAGGGACTCCGAG
TTGTGAAAATTAGCTGGGGACAGGGCCACTTCTGGGAGCTTTGGCGCTCTGGCCTGTGGA
ACAT
gtctgactggatttgggatgcacgctggcttgagggaaatatagccttggccctgggcca
caactcagtggtgctatatgaccctgtagtagggtgcatcctgcaagaggtgccctgcac
agacaggtgcaccctctcttcagcctgcctgattggagacgcctggaaggagctgaccat
EXON 3  263 bp
accctggggcctgaatatggagtgcccagcttcatgcagcctgatgacctggagcctggc
agtgaggggcccgacttgactgacattgtgatcacatgtagtgaggacactactgtctgt
gtcctagcactccctacaaccacaggctcagcccacgcactcacagctgtttgtaaccat
ATCTCCTCGGTACGTGCTGTGGCTGTGTGGGGCATTGGCACCCCAGGTGGCCCTCAGGAT
CCTCAGCCAGGCCTGACTGCCCATGTGGTGTCTGCGGGGGGGCGGGCTGAGATGCACTGC
TTCAGCATCATGGTTACTCCGGACCCCAGCACCCCAAGCCGCCTCGCCTGCCATGTCATG
CACCTTTCGTCCCACCGGCTAGATGAGTATTGGGACCGGCAACGCAATCGGCATCGGATG
GTTAAGGTAGACCCAGAGACCAG
gtaatatatgctcctgggcagggtgtggtatgggtcatgcagatgctcccaggcttgcag
gctccacctgacagctgcatgttgtctctgcaggtacatgtcccttgctgtgtgtgaact
tgaccagcccggccttggcccccttgtggctgcagcctgtagtgatggggccgtaaggtg
EXON 4  84 bp
catgcacctttcgtcccaccggctagatgagtattgggaccggcaacgcaatcggcatcg
gatggttaaggtagacccagagaccaggtaatatatgctcctgggcagggtgtggtatgg
gtcatgcagatgctcccaggcttgcaggctccacctgacagctgcatgttgtctctgcag
GTACATGTCCCTTGCTGTGTGTGAACTTGACCAGCCCGGCCTTGGCCCCCTTGTGGCTGC
AGCCTGTAGTGATGGGGCCGTAAG
gtgagagcatagggcccagtgggacaggagacaaaggaagtaaggttgtctaggatgcgt
tctgagctgggccaccccccgccccccaggctctttcttttgcaggattctgggcggatt
ctgcagctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactccttt
EXON 5  117 bp
tctgcaggtacatgtcccttgctgtgtgtgaacttgaccagcccggccttggcccccttg
tggctgcagcctgtagtgatggggccgtaaggtgagagcatagggcccagtgggacagga
gacaaaggaagtaaggttgtctaggatgcgttctgagctgggccaccccccgccccccag
GCTCTTTCTTTTGCAGGATTCTGGGCGGATTCTGCAGCTCCTTGCTGAAACCTTCCACCA
TAAGCGATGTGTCCTCAAGGTCCACTCCTTTACACACGAGGCACCCAACCAGAGGCG
gtgagaggggctggatgatggtcctgcatgggctgggttggggggttcctgttgagcttc
atctctgttattgaccaggctgtcttttcctggctctcaggaggctcctcctgtgcagcg
cagctactgatggcagcctggctttctgggatctcaccaccatgctagaccatgactcca
EXON 6  119 bp
ctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactcctttacacac
gaggcacccaaccagaggcggtgagaggggctggatgatggtcctgcatgggctgggttg
gggggttcctgttgagcttcatctctgttattgaccaggctgtcttttcctggctctcag
GAGGCTCCTCCTGTGCAGCGCAGCTACTGATGGCAGCCTGGCTTTCTGGGATCTCACCAC
CATGCTAGACCATGACTCCACTGTCCTGGAGCCTCCAGTGGATCCTGGGCTTCCCTACC
gtgagtagctaatgtgcaaccatggctacccctcctcacctgtcacatagccctcacaca
tgtggcaggcggggccctgacaactaccctcttcctcttccttcagggcttggcaccccc
tccctgactctccaggcccacagctgtggtatcaacagcctgcacaccttgcccacccgt
EXON 7  1121 bp
ctgggatctcaccaccatgctagaccatgactccactgtcctggagcctccagtggatcc
tgggcttccctaccgtgagtagctaatgtgcaaccatggctacccctcctcacctgtcac
atagccctcacacatgtggcaggcggggccctgacaactaccctcttcctcttccttcag
GGCTTGGCACCCCCTCCCTGACTCTCCAGGCCCACAGCTGTGGTATCAACAGCCTGCACA
CCTTGCCCACCCGTGAGGGCCACCATCTCGTGGCCAGTGGCAGTGAAGATGGATCCCTCC
ATGTCTTCGTGCTTGCTGTGGAGATGCTACAGCTAGAAGAGGCTGTGGGAGAGGCTGGGC
TGGTACCCCAGCTGCGTGTGCTAGAGGAATACTCTGTCCCCTGTGCACATGCTGCCCATG
TGACAGGCCTCAAGATCCTAAGCCCAAGCATCATGGTCTCAGCCTCCATTGATCAACGGC
TGACCTTCTGGCGTCTGGGGCATGGTGAACCCACCTTCATGAATAGCACTGTGTTCCATG
TGCCTGATGTGGCTGACATGGACTGCTGGCCTGTGAGCCCTGAGTTTGGCCACCGTTGTG
CCCTTGGGGGTCAGGGGCTTGAGGTTTACAACTGGTATGACTGAGGTATCCTGCGGTGGC
TGGCGTGCTGGGCATGGGGCCTGCTCACAGACAGCATGGAGCAGGGATGGGCTGTCTGTG
CCCATGCTCAGCATGCCTTGAGGGGAGGAGGTGGTGGCCGTGGGTTCCTGATGTCGGTGC
AGGAGCTGAAGGTGAGTGGAGTGCTGCCAAGAATATGCCCGACTCCCCATGACAAGACAG
AACTTTGTAACAAACAGTACCAATTTATTTTGGCCGTGGGTTTTTGCTTTTTTTCCAGTT
GATGACTTTGTGAACATTCCCAGGTATTGGAGCCTCTGTGGCCTTAAATGTGGCTCAGTG
GAGGGAGACCCAGCATAGCCAGGCCAGTATGGAGCACCTCACGCACAGCTCTCAGAAGCT
GCAGGCGGACGAACATCTGACCAAAGAGGTGTGGTCGAGGCTCCTGAAAGAGAAAGGGCC
TGCTGGTCTCATCCTCTGCTTCCTTTGCCTTTACCCTATACCTCTCTGCACGTCCCACCC
CATTTTGCTGTGTGCTCACCCCCAGGATGTGTACCCGGTTGTAGTAGGAGCTGAAATCCA
TGCTGAGCTGTACCAGGAACTTGCATATCTAGAGACAGAGACTGAGTCACTGGCCCATCT
CTTTGCTCTTGTGCCCCAGGCCAGAATAAAGAATAGAGTGT
agagtgtcctggttgtctatgcctcaccatctctgtgcgtacagcaatgtggagccccgg
ggctgtgcagtccagcactgctgtccggctcagcagatccggaaaggggaggatactgtt
gaagagcaacaaccactcaccctgttggggagaaaggtgctgggaggggaagtccaggcc