Gene WDR6 Variant 2
DNA : 8.56 KbNT_022517
mRNA : 4066 bp NM_018031
CDS : 3366 bp NP_060501
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  139 bp
ggcgaggggcgggatgcccctccgcgggccccgccaatgatgagctggattgcgtgggac
gaagggtcgtcattggacaaccgccgcgggcgccctggtctctgctacctgtagctgagg
gcgctgttgatgggcagcgcggcgcgctgggaaggctcgttctcgcgagagttcagctcc
CTTCTTAGCCGTGGCTGCCTCAGCACCTCGAGGATCGACATGGACGCTCTCGAGGACTAC
GTTTGGCCGCGGGCAACCTCGGAGCTTATACTCCTCCCAGTGACGGGTCTGGAGTGCGTG
GGGGACCGGCTGTTGGCGG
gtgaggcttggcttgaggcacgcctggtggaaagggggaaagaaacagcgcctcccaggg
gcggtgccacagggacaaaaggggtgccctgaggagaaggacgggcagcaggttgaggcc
gatcggaggtgggaagggagccccggagatggcggggacgagggccaacctgaagagggc
EXON 2  2482 bp
caggcgtgagccaccgcacccggccgagaccaaggattttctaagattcaagctgcagga
ttgtgtgtcctgatgcattcataggctacatgccgagaagtttccctgatccccatctct
tccctgtgggtcatcagagttaggtacctagctctgacatggctctttgcctctatctag
GTGAGGGTCCCGATGTCCTGGTGTACAGCTTGGACTTTGGTGGGCATCTGCGGATGATAA
AGCGAGTGCAGAACCTGCTTGGCCACTATCTTATCCATGGCTTCCGGGTACGGCCAGAGC
CTAATGGAGACCTTGACTTGGAGGCCATGGTGGCTGTGTTTGGAAGCAAGGGACTCCGAG
TTGTGAAAATTAGCTGGGGACAGGGCCACTTCTGGGAGCTTTGGCGCTCTGGCCTGTGGA
ACATGTCTGACTGGATTTGGGATGCACGCTGGCTTGAGGGAAATATAGCCTTGGCCCTGG
GCCACAACTCAGTGGTGCTATATGACCCTGTAGTAGGGTGCATCCTGCAAGAGGTGCCCT
GCACAGACAGGTGCACCCTCTCTTCAGCCTGCCTGATTGGAGACGCCTGGAAGGAGCTGA
CCATAGTGGCAGGTGCTGTTTCCAACCAGCTCTTGGTCTGGTACCCAGCAACTGCCTTAG
CAGACAACAAACCTGTAGCACCTGACCGACGAATCAGTGGGCATGTGGGCATCATCTTCA
GCATGTCATACCTGGAAAGCAAGGGATTGCTGGCTACAGCTTCAGAAGACCGAAGCGTTC
GTATCTGGAAGGTGGGCGACCTGCGAGTGCCTGGGGGTCGGGTGCAGAATATTGGGCACT
GCTTTGGGCACAGCGCCCGTGTGTGGCAGGTCAAGCTTCTAGAGAATTACCTTATCAGTG
CAGGAGAGGATTGTGTCTGCTTGGTGTGGAGCCATGAAGGTGAGATCCTCCAGGCCTTTC
GGGGACACCAGGGACGTGGGATCCGGGCCATAGCTGCCCATGAGAGGCAGGCCTGGGTGA
TCACTGGGGGTGATGACTCAGGCATTCGGCTGTGGCACTTGGTAGGGCGTGGGTACCGGG
GATTGGGGGTCTCGGCTCTCTGCTTCAAGTCCCGTAGTAGGCCAGGTACACTCAAGGCTG
TGACTCTGGCTGGCTCTTGGCGACTGCTGGCAGTGACTGATACAGGGGCCCTGTATCTCT
ATGACGTCGAGGTCAAGTGCTGGGAGCAGCTGCTAGAGGATAAACATTTCCAGTCCTACT
GCCTGCTGGAGGCAGCTCCTGGTCCCGAGGGCTTCGGATTGTGTGCTATGGCCAATGGGG
AAGGTCGTGTCAAGGTTGTCCCCATCAACACTCCAACTGCTGCTGTGGACCAGACCCTGT
TTCCTGGGAAGGTGCACAGCTTGAGCTGGGCCCTGCGTGGTTATGAGGAGCTCCTGTTGC
TGGCATCGGGCCCTGGCGGGGTAGTAGCTTGCCTAGAGATCTCAGCCGCACCCTCTGGCA
AGGCCATCTTTGTCAAGGAACGTTGTCGGTACCTGCTGCCCCCAAGCAAGCAGAGATGGC
ACACATGCAGTGCCTTCCTACCCCCAGGTGACTTCCTGGTGTGTGGTGACCGCCGGGGCT
CTGTGCTGCTATTCCCCTCCAGACCAGGTCTGCTCAAGGACCCTGGGGTGGGAGGCAAGG
CTCGGGCTGGTGCTGGGGCACCTGTAGTGGGTAGTGGTAGTAGTGGGGGTGGGAATGCTT
TCACTGGGTTGGGCCCAGTGTCTACCCTGCCCTCTCTGCACGGGAAGCAGGGTGTGACCT
CAGTCACATGCCATGGTGGCTATGTGTATACCACAGGGCGTGATGGAGCCTACTACCAGC
TGTTTGTACGAGACGGCCAGCTCCAGCCAGTCCTAAGGCAGAAGTCCTGTCGAGGCATGA
ACTGGCTAGCTGGGCTCCGTATAGTGCCCGATGGGAGCATGGTTATCCTGGGTTTCCATG
CCAATGAGTTTGTGGTGTGGAACCCTCGGTCACACGAGAAGCTGCACATCGTCAACTGTG
GTGGAGGGCACCGTTCGTGGGCATTCTCTGATACTGAGGCGGCCATGGCCTTTGCTTACC
TCAAGGATGGGGATGTCATGCTGTACAGGGCTCTGGGTGGCTGCACCCGGCCACACGTGA
TTCTCCGGGAGGGTCTGCATGGCCGTGAGATCACTTGTGTAAAGCGTGTGGGCACCATTA
CCCTGGGGCCTGAATATGGAGTGCCCAGCTTCATGCAGCCTGATGACCTGGAGCCTGGCA
GTGAGGGGCCCGACTTGACTGACATTGTGATCACATGTAGTGAGGACACTACTGTCTGTG
TCCTAGCACTCCCTACAACCACAGGCTCAGCCCACGCACTCACAGCTGTTTGTAACCATA
TCTCCTCGGTACGTGCTGTGGCTGTGTGGGGCATTGGCACCCCAGGTGGCCCTCAGGATC
CTCAGCCAGGCCTGACTGCCCATGTGGTGTCTGCGGGGGGGCGGGCTGAGATGCACTGCT
TCAGCATCATGGTTACTCCGGACCCCAGCACCCCAAGCCGCCTCGCCTGCCATGTCATGC
ACCTTTCGTCCCACCGGCTAGATGAGTATTGGGACCGGCAACGCAATCGGCATCGGATGG
TTAAGGTAGACCCAGAGACCAG
gtaatatatgctcctgggcagggtgtggtatgggtcatgcagatgctcccaggcttgcag
gctccacctgacagctgcatgttgtctctgcaggtacatgtcccttgctgtgtgtgaact
tgaccagcccggccttggcccccttgtggctgcagcctgtagtgatggggccgtaaggtg
EXON 3  84 bp
catgcacctttcgtcccaccggctagatgagtattgggaccggcaacgcaatcggcatcg
gatggttaaggtagacccagagaccaggtaatatatgctcctgggcagggtgtggtatgg
gtcatgcagatgctcccaggcttgcaggctccacctgacagctgcatgttgtctctgcag
GTACATGTCCCTTGCTGTGTGTGAACTTGACCAGCCCGGCCTTGGCCCCCTTGTGGCTGC
AGCCTGTAGTGATGGGGCCGTAAG
gtgagagcatagggcccagtgggacaggagacaaaggaagtaaggttgtctaggatgcgt
tctgagctgggccaccccccgccccccaggctctttcttttgcaggattctgggcggatt
ctgcagctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactccttt
EXON 4  117 bp
tctgcaggtacatgtcccttgctgtgtgtgaacttgaccagcccggccttggcccccttg
tggctgcagcctgtagtgatggggccgtaaggtgagagcatagggcccagtgggacagga
gacaaaggaagtaaggttgtctaggatgcgttctgagctgggccaccccccgccccccag
GCTCTTTCTTTTGCAGGATTCTGGGCGGATTCTGCAGCTCCTTGCTGAAACCTTCCACCA
TAAGCGATGTGTCCTCAAGGTCCACTCCTTTACACACGAGGCACCCAACCAGAGGCG
gtgagaggggctggatgatggtcctgcatgggctgggttggggggttcctgttgagcttc
atctctgttattgaccaggctgtcttttcctggctctcaggaggctcctcctgtgcagcg
cagctactgatggcagcctggctttctgggatctcaccaccatgctagaccatgactcca
EXON 5  119 bp
ctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactcctttacacac
gaggcacccaaccagaggcggtgagaggggctggatgatggtcctgcatgggctgggttg
gggggttcctgttgagcttcatctctgttattgaccaggctgtcttttcctggctctcag
GAGGCTCCTCCTGTGCAGCGCAGCTACTGATGGCAGCCTGGCTTTCTGGGATCTCACCAC
CATGCTAGACCATGACTCCACTGTCCTGGAGCCTCCAGTGGATCCTGGGCTTCCCTACC
gtgagtagctaatgtgcaaccatggctacccctcctcacctgtcacatagccctcacaca
tgtggcaggcggggccctgacaactaccctcttcctcttccttcagggcttggcaccccc
tccctgactctccaggcccacagctgtggtatcaacagcctgcacaccttgcccacccgt
EXON 6  1125 bp
ctgggatctcaccaccatgctagaccatgactccactgtcctggagcctccagtggatcc
tgggcttccctaccgtgagtagctaatgtgcaaccatggctacccctcctcacctgtcac
atagccctcacacatgtggcaggcggggccctgacaactaccctcttcctcttccttcag
GGCTTGGCACCCCCTCCCTGACTCTCCAGGCCCACAGCTGTGGTATCAACAGCCTGCACA
CCTTGCCCACCCGTGAGGGCCACCATCTCGTGGCCAGTGGCAGTGAAGATGGATCCCTCC
ATGTCTTCGTGCTTGCTGTGGAGATGCTACAGCTAGAAGAGGCTGTGGGAGAGGCTGGGC
TGGTACCCCAGCTGCGTGTGCTAGAGGAATACTCTGTCCCCTGTGCACATGCTGCCCATG
TGACAGGCCTCAAGATCCTAAGCCCAAGCATCATGGTCTCAGCCTCCATTGATCAACGGC
TGACCTTCTGGCGTCTGGGGCATGGTGAACCCACCTTCATGAATAGCACTGTGTTCCATG
TGCCTGATGTGGCTGACATGGACTGCTGGCCTGTGAGCCCTGAGTTTGGCCACCGTTGTG
CCCTTGGGGGTCAGGGGCTTGAGGTTTACAACTGGTATGACTGAGGTATCCTGCGGTGGC
TGGCGTGCTGGGCATGGGGCCTGCTCACAGACAGCATGGAGCAGGGATGGGCTGTCTGTG
CCCATGCTCAGCATGCCTTGAGGGGAGGAGGTGGTGGCCGTGGGTTCCTGATGTCGGTGC
AGGAGCTGAAGGTGAGTGGAGTGCTGCCAAGAATATGCCCGACTCCCCATGACAAGACAG
AACTTTGTAACAAACAGTACCAATTTATTTTGGCCGTGGGTTTTTGCTTTTTTTCCAGTT
GATGACTTTGTGAACATTCCCAGGTATTGGAGCCTCTGTGGCCTTAAATGTGGCTCAGTG
GAGGGAGACCCAGCATAGCCAGGCCAGTATGGAGCACCTCACGCACAGCTCTCAGAAGCT
GCAGGCGGACGAACATCTGACCAAAGAGGTGTGGTCGAGGCTCCTGAAAGAGAAAGGGCC
TGCTGGTCTCATCCTCTGCTTCCTTTGCCTTTACCCTATACCTCTCTGCACGTCCCACCC
CATTTTGCTGTGTGCTCACCCCCAGGATGTGTACCCGGTTGTAGTAGGAGCTGAAATCCA
TGCTGAGCTGTACCAGGAACTTGCATATCTAGAGACAGAGACTGAGTCACTGGCCCATCT
CTTTGCTCTTGTGCCCCAGGCCAGAATAAAGAATAGAGTGTAGAG
tgtcctggttgtctatgcctcaccatctctgtgcgtacagcaatgtggagccccggggct
gtgcagtccagcactgctgtccggctcagcagatccggaaaggggaggatactgttgaag
agcaacaaccactcaccctgttggggagaaaggtgctgggaggggaagtccaggcctcct