Gene WDR6 Variant 1
DNA : 8.56 KbNT_022517
mRNA : 746 bp NM_052825
CDS : 651 bp NP_439890
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  139 bp
ggcgaggggcgggatgcccctccgcgggccccgccaatgatgagctggattgcgtgggac
gaagggtcgtcattggacaaccgccgcgggcgccctggtctctgctacctgtagctgagg
gcgctgttgatgggcagcgcggcgcgctgggaaggctcgttctcgcgagagttcagctcc
CTTCTTAGCCGTGGCTGCCTCAGCACCTCGAGGATCGACATGGACGCTCTCGAGGACTAC
GTTTGGCCGCGGGCAACCTCGGAGCTTATACTCCTCCCAGTGACGGGTCTGGAGTGCGTG
GGGGACCGGCTGTTGGCGG
gtgaggcttggcttgaggcacgcctggtggaaagggggaaagaaacagcgcctcccaggg
gcggtgccacagggacaaaaggggtgccctgaggagaaggacgggcagcaggttgaggcc
gatcggaggtgggaagggagccccggagatggcggggacgagggccaacctgaagagggc
EXON 2  473 bp
caggcgtgagccaccgcacccggccgagaccaaggattttctaagattcaagctgcagga
ttgtgtgtcctgatgcattcataggctacatgccgagaagtttccctgatccccatctct
tccctgtgggtcatcagagttaggtacctagctctgacatggctctttgcctctatctag
GTGAGGGTCCCGATGTCCTGGTGTACAGCTTGGACTTTGGTGGGCATCTGCGGATGATAA
AGCGAGTGCAGAACCTGCTTGGCCACTATCTTATCCATGGCTTCCGGGTACGGCCAGAGC
CTAATGGAGACCTTGACTTGGAGGCCATGGTGGCTGTGTTTGGAAGCAAGGGACTCCGAG
TTGTGAAAATTAGCTGGGGACAGGGCCACTTCTGGGAGCTTTGGCGCTCTGGCCTGTGGA
ACATGTCTGACTGGATTTGGGATGCACGCTGGCTTGAGGGAAATATAGCCTTGGCCCTGG
GCCACAACTCAGTGGTGCTATATGACCCTGTAGTAGGGTGCATCCTGCAAGAGGTGCCCT
GCACAGACAGGTGCACCCTCTCTTCAGCCTGCCTGATTGGAGACGCCTGGAAGGAGCTGA
CCATAGTGGCAGGTGCTGTTTCCAACCAGCTCTTGGTCTGGTACCCAGCAACT
gccttagcagacaacaaacctgtagcacctgaccgacgaatcagtgggcatgtgggcatc
atcttcagcatgtcatacctggaaagcaagggattgctggctacagcttcagaagaccga
agcgttcgtatctggaaggtgggcgacctgcgagtgcctgggggtcgggtgcagaatatt
EXON 3  110 bp
ttggagcctctgtggccttaaatgtggctcagtggagggagacccagcatagccaggcca
gtatggagcacctcacgcacagctctcagaagctgcaggcggacgaacatctgaccaaag
aggtgtggtcgaggctcctgaaagagaaagggcctgctggtctcatcctctgcttccttt
GCCTTTACCCTATACCTCTCTGCACGTCCCACCCCATTTTGCTGTGTGCTCACCCCCAGG
ATGTGTACCCGGTTGTAGTAGGAGCTGAAATCCATGCTGAGCTGTACCAG
gaacttgcatatctagagacagagactgagtcactggcccatctctttgctcttgtgccc
caggccagaataaagaatagagtgtagagtgtcctggttgtctatgcctcaccatctctg
tgcgtacagcaatgtggagccccggggctgtgcagtccagcactgctgtccggctcagca
EXON 4  24 bp
ttgcctttaccctatacctctctgcacgtcccaccccattttgctgtgtgctcaccccca
ggatgtgtacccggttgtagtaggagctgaaatccatgctgagctgtaccaggaacttgc
atatctagagacagagactgagtcactggcccatctctttgctcttgtgccccaggccag
AATAAAGAATAGAGTGTAGAGTGT
cctggttgtctatgcctcaccatctctgtgcgtacagcaatgtggagccccggggctgtg
cagtccagcactgctgtccggctcagcagatccggaaaggggaggatactgttgaagagc
aacaaccactcaccctgttggggagaaaggtgctgggaggggaagtccaggcctccttgt