Gene UQCRC1 Variant 1
DNA : 11.03 KbNT_022517
mRNA : 1985 bp NM_003365
CDS : 1443 bp NP_003356
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  486 bp
ttctaaagaaacaaaaattaccgggcataatcccagctactcgggaggctgaggcaggag
aatcgcttgaagccgggaggcggaggttgcagtgagccgagatcgcgccattgcactcca
gcctgggcgacagagcgagaccctgtctcagaaaataaaaaataaataaagagaaaaaaa
TACTGACTTTCAGCACCAACTTGTGGTCCCAGGTAAGTTTCCACGCTGGTACTTTAGCCC
TGGGCTCGAACCTGCGGACACGCTGTGGCTGCAACTCCCCGCCCGCCAGACCTCAGTACG
CAGCGCGGCTGGTGAGAAACATAATGCACTCTGACTTCCACGCGTGGAATGGGGAGATGG
ACTGCACGGCGGGCGGACCTGCTCGGGCTGATGGACGGCAGGTGGACTGATGTGCGCAGG
GACTGGCGGCAGCGCGGTCAGAGCCAGTCAGCCAAAGCCAGGCCAGCACAATAGACTGTC
CCGGTTCCCGCCAGGAGGCGGCCGAGCACCAACTGTACGGTACTGCGCCTGCGCCGCGAC
CGCCAACGCGCCCAGTCTACGCTTGCGCGGCGCAACAGGGCCGACTGCAGCTGGAAGATG
GCGGCGTCCGTGGTCTGTCGGGCCGCTACCGCCGGGGCACAAGTGCTATTGCGCGCCCGC
CGCTCG
gtgaggtggtggcgagagcgcggggcttcgggacagggcttcgggaagcggacaggtgtg
ggctgttagcagtggcaggtcgaggtggggaggacgcggggtcagggccgtgggaaggtc
acggcggagggcggggaaaggtatctcgccgcttgcctaggggcggggttcgggggtcct
EXON 2  141 bp
cagtggcaggtcgaggtggggaggacgcggggtcagggccgtgggaaggtcacggcggag
ggcggggaaaggtatctcgccgcttgcctaggggcggggttcgggggtcctcctgaggac
ctgggaggtggggagcgatcccctgaccgagtcctcactcgcggctgttcccttccacag
CCGGCCCTGCTGCGGACGCCAGCCTTGCGGAGTACGGCAACCTTCGCTCAGGCGCTCCAG
TTCGTGCCGGAGACGCAGGTTAGCCTGCTGGACAACGGCCTGCGTGTGGCCTCCGAGCAG
TCCTCTCAGCCCACTTGCACG
gtgagttggggacgcttttggggagagggcctccaggttgggcctgccgtcttttccctg
gttggggtgtgaccttgggctcgagtcttcccgtttgtggtttgggttcggacccaggac
cactcaccccgagaatggccccattccctaccctagccacgccttggcttcacgggacaa
EXON 3  87 bp
gcccctgttttccaagcatgactgtgtccccaagcacaggggtcctgctggggcagctct
ccctgactccaggattcataagtccctgcctggggcttgtactgagtcactcaggtgggg
tgtgagtagggggctggggagtggtttgtttgtaaccttttctggtggcttcttgaccag
GTGGGAGTGTGGATTGATGTTGGCAGCCGTTTTGAGACTGAGAAGAATAATGGGGCAGGC
TACTTTTTGGAGCATCTGGCTTTCAAG
gtgaggctcttaaagtctgtctcctctgggcttagggctgcctgttgtccctcctgagga
tgaaggtcagaaaaattagcctgattatgggcctcagttgcggggctgatgtctggctgg
ctttcctaaaaggagccacatgagcttaacctctcctgagtgggcacgtatctgatgagc
EXON 4  130 bp
tttggtcacctcaaggcctgcttagtgcttggtaaacagactctgggatctgtgtcccca
gagtctatgctgagggaggtacctgtggaccagtggtcctgctgggtgtttagcctctga
ggacagggttcttgggttcctgtgtagctcctgattgttctggttgatatctggttccag
GGAACAAAGAATCGGCCTGGCAGTGCCCTGGAGAAGGAGGTGGAGAGCATGGGGGCCCAT
CTTAATGCCTACAGCACCCGGGAGCACACAGCTTACTACATCAAGGCGCTGTCCAAGGAT
CTGCCGAAAG
gtaacacctggaggaagaggcggggacagagggcagggaagcagaggacagctacctagg
agcccctggctgaccacagaatcatattacccttagcgtatggctttgcagctgggcaac
taggggtgggcagcaggagatgccaggcctggggattttgtgctgtcgttggtctgcagt
EXON 5  199 bp
agcagaggacagctacctaggagcccctggctgaccacagaatcatattacccttagcgt
atggctttgcagctgggcaactaggggtgggcagcaggagatgccaggcctggggatttt
gtgctgtcgttggtctgcagtggtccacctggcacctaaacatgtcctccttgcatctag
CTGTGGAGCTCCTGGGTGACATTGTGCAGAACTGTAGTCTGGAAGACTCACAGATTGAGA
AGGAACGTGATGTGATCCTGCGGGAGATGCAGGAGAATGATGCATCTATGCGAGATGTGG
TCTTTAACTACCTGCATGCCACAGCATTCCAGGGCACACCTCTAGCCCAGGCTGTGGAGG
GGCCCAGTGAGAATGTCAG
gtgagagttggctggccttgtggggggatgcttgctccattctggcctggccagaccctt
tccaggtcacatttttagttggctagctgtcggggttattttcctgagttatgcaactgg
agacagtttctgtatccatgtggtccagtgagtcttttttaatggctttgtgggcttcac
EXON 6  80 bp
ctctgggccctggaggggtgggtggcagagacaggggaagggggttggggagtgtgctag
ggcccactcttcggagaaaccatgcctctcctagtctgcctcctcagtcccattcatgca
tgtaccccaactcactccagtgtggtagaggtgttgacacactgaccatatgtcttgtag
GAAGCTGTCTCGTGCAGACTTGACCGAGTACCTCAGCACACATTACAAGGCCCCTCGAAT
GGTGCTGGCAGCAGCTGGAG
gtgagtgatggaatcactgaagtcctgggtagtggggtcccagccttggttatcaaagcc
gaggtcctggttcccaccataggggacctttcaccccaggggactctgctcccaccctaa
ccttgaggggaatgaccttcctcctgtgctctctgaggtgggataggattctaccctgcc
EXON 7  116 bp
cctgtccacaaggcagggtctgtctgaggaggaccttctttcctcaccctgttctaatgt
cacatactcctggtttctcccactaagacaggacatgggggtcctctgcctgtctgtgaa
tcgccccaccctgtgccttgggccctggctggtcagtaatgccactgtctgtctcagcag
GAGTGGAGCACCAGCAACTGTTAGACCTCGCCCAGAAGCACCTCGGTGGCATCCCATGGA
CATATGCAGAGGACGCTGTGCCCACTCTTACTCCATGCCGCTTCACTGGCAGTGAG
gtatgctgccttttgggcaggagtagtgctcagctgggggcctgtgggaggacccccatg
tgcatggttatcctggtgactccagagatacctcagcagttgggaaggggttctgtggct
gctgcatcacaggcacacatgttcacacacatacaccctctacccacacctgccaccttt
EXON 8  144 bp
ccccatgtgcatggttatcctggtgactccagagatacctcagcagttgggaaggggttc
tgtggctgctgcatcacaggcacacatgttcacacacatacaccctctacccacacctgc
caccttttctgttcccctggcagtctggctgttcctcagccttgtcatgtactgtttcag
ATCCGCCACCGTGATGATGCTCTACCTTTTGCCCACGTGGCCATTGCAGTAGAGGGTCCT
GGCTGGGCCAGCCCGGACAATGTGGCCTTGCAAGTGGCCAATGCCATCATCGGCCACTAT
GACTGCACTTATGGTGGTGGCGTG
gtgagtgccagcgcgagcatgggacctcgccttcagggaagagagggtgctggggctgtg
tgctcctgtgcgtgggggtcacagtgtgcgttgaagacaagagggtgggtgctgaccacc
tatccccctggcagcacctgtccagcccactggcttcaggtgctgtggccaacaagctat
EXON 9  161 bp
caatgccatcatcggccactatgactgcacttatggtggtggcgtggtgagtgccagcgc
gagcatgggacctcgccttcagggaagagagggtgctggggctgtgtgctcctgtgcgtg
ggggtcacagtgtgcgttgaagacaagagggtgggtgctgaccacctatccccctggcag
CACCTGTCCAGCCCACTGGCTTCAGGTGCTGTGGCCAACAAGCTATGCCAGAGTTTCCAG
ACCTTCAGCATCTGCTATGCAGAGACGGGCTTGCTGGGTGCACACTTTGTCTGTGACCGA
ATGAAAATCGATGACATGATGTTCGTCCTGCAAGGGCAGTG
gtaagtggcagcctggtattcctaggtgggatggcggctttaaccagcacagtgggaggc
tgagagatgacacactggctcagaatgaataccacccacccccccactttaggatgcgcc
tgtgtaccagtgccacggagagtgaggtggcccggggcaaaaacatcctcagaaatgccc
EXON 10  86 bp
ctgggtgcacactttgtctgtgaccgaatgaaaatcgatgacatgatgttcgtcctgcaa
gggcagtggtaagtggcagcctggtattcctaggtgggatggcggctttaaccagcacag
tgggaggctgagagatgacacactggctcagaatgaataccacccacccccccactttag
GATGCGCCTGTGTACCAGTGCCACGGAGAGTGAGGTGGCCCGGGGCAAAAACATCCTCAG
AAATGCCCTGGTATCTCATCTAGATG
gtgagtcctacagctcagcggggaggggtagagtacatcttgccagcgacagcaccaagg
tggccactgctcctaactaaccaaggttagaaaggaaaactttgaagaccacgccatgcc
ccatcaccccacccttggagatgcaggcaggtgtgagacaggtccacagcccatcactgc
EXON 11  89 bp
gtgtgagacaggtccacagcccatcactgccataataggtgaccatagaagagagggctg
tgatctgagtcagcatgaggtcagggaggtccttgtcaacctgaggctggagattgtttg
tgtacctgtgggtccaggattgggctgggtggacctctgagccttctctcacccttaaag
GCACTACTCCTGTGTGTGAGGACATCGGACGCAGCCTCCTGACCTATGGCCGCCGCATCC
CCCTGGCTGAATGGGAAAGCCGGATTGCG
gtaacatggacccctgggagaggttctggagtcttggcctggcagacacctgggaggtgt
agggttggggcctggcatagcgcagcctgctcctataggcatccctggtgtcctaggcag
ctgtcacctgcaggggtagcatagtgggagggcagggcataggtgctgatggctgtggag
EXON 12  76 bp
ctgtggagatgggcggggcccatggaggtctatagcagggatcccttctgcctttcctct
tttgggctggggacagctgcatgctgcctgtgggagatctctgctagttggatgatgctg
actggctgaggtggtggccaggtgcccgttagccagtatgccctctgcctcaccctgcag
GAGGTGGATGCCAGTGTGGTACGTGAGATCTGCTCCAAGTACATCTATGACCAGTGCCCA
GCAGTGGCTGGATATG
gtaagtggcctagggggtctgctctttgtttatttcctcaggccgttctcttggcctccc
cttccacctctgctcccgcactgctgctcagcttacagagcagccagttaaggccccaag
cagctctccccagtcccctggctgccagggagttcttgctcagaaaacctgtcccagcag
EXON 13  190 bp
aagggccagaacatgaagggacaggctcagcacccctgggggaatgttctctcctctctt
tccactcaaagcctgtcttgtgctgctctgggcagcatctccgagctgggtgcggcacag
ggccaggtgtccctgtgcaggccaggtaccccaccctgacgctccaccctatccccacag
GCCCCATTGAGCAGCTCCCAGACTACAACCGGATCCGTAGCGGCATGTTCTGGCTGCGCT
TCTAGGCGGGAAGCCTATGTAAGCAAGAGGGCAGGGCCGGGGTTTGTGGTCCCCCCCCCA
CCACAAACACAGCACTTCGGCTCCTCTAACCTGTGCCACAGGTGACCACCAATAAAATCC
TCTGCTGAGA
agtgtgtcatccctcttttggcattggcatggagtccatggggcagtagatggggagcaa
ggacttccctctagttctgtggctcctggatcctcctgccttcccacaggctgatgtgtc
ctcagccaggggcaagcgtgggggttgcagctgaggccggaagtctttgatgcctacagg