Gene TRIM42 Variant 1
DNA : 23.11 KbNT_005612
mRNA : 2538 bp NM_152616
CDS : 2172 bp NP_689829
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  532 bp
acaactaaacttccaggatgctcattgcatcaccactcctctacagctggttccatggaa
gcatggagtttccaccaacataccagctaccacccacaaggccgcatcctgctatctacc
tagcatggtagagagacagggattgtgacataagcaaataccctcagactgatatatgta
AATGCCAGCCTATGAGCTTCCTGGTAGGGACACCAGCTGTGAAGTCCTCATAACAGCCAA
CTTCTTGCAACTTTCAAGCTGACGGCCTCAGGAATGGGAGGAAGGACTCCTCCACTGGAG
AACTGATAGCAGTATTCTGGTAGAGGAGGCATCAAGAGTCCTGGGAGGCCGGTGGTAATC
ATGTAGGCACCATGGAAACTGCTATGTGCGTTTGCTGTCCATGTTGTACATGGCAGAGAT
GTTGTCCTCAGTTATGCTCCTGTCTGTGCTGCAAGTTCATCTTCACCTCAGAGCGGAACT
GCACCTGCTTCCCCTGCCCTTACAAAGATGAGCGGAACTGCCAGTTCTGCCACTGCACCT
GTTCTGAGAGCCCCAACTGCCATTGGTGTTGCTGCTCTTGGGCCAATGATCCCAACTGTA
AGTGCTGCTGCACAGCCAGCAGCAATCTCAACTGCTACTACTATGAGAGCCGCTGCTGCC
GCAATACCATCATCACTTTCCACAAGGGCCGCCTCAGGAGCATCCATACCTC
gtaagtgccaggcaccagatgtggggccgcattgggtcatgaaaactagggaccacttgc
cagctgtgaagtctacagggcaggccagtgagcctctgagttcatttctttatctaaaag
gaggagccaagaattttgtagcaattaattgtatcctaaatggtcactatgtatgtagac
EXON 2  698 bp
gtcaccccgctgaaaaacggtggagacagattgagaacgcaggcaccttagcgcccagct
caggctcctcaccaccacactagactgcccctcaggaaccaagagttctttcagaggtag
agaagcagagcaagctcttgagcctgcctcctgaaaccctgcctttgcttctcctttcag
CTCCAAGACTGCCCTGCGCACTGGGAGCAGCGATACCCAGGTGGATGAAGTAAAGTCAAT
ACCAGCCAACAGTCACCTGGTGAACCACCTCAATTGCCCCATGTGCAGCCGGCTGCGCCT
GCACTCATTCATGCTGCCCTGCAACCACAGCCTGTGCGAGAAGTGCCTGCGGCAGCTGCA
GAAGCACGCCGAGGTCACCGAGAACTTCTTCATCCTCATCTGCCCAGTGTGCGACCGCTC
GCACTGCATGCCCTACAGCAACAAGATGCAGCTGCCCGAGAACTACCTGCACGGGCGTCT
CACCAAGCGCTACATGCAGGAGCACGGCTACCTCAAGTGGCGCTTTGACCGCTCCTCCGG
GCCCATCCTCTGCCAGGTCTGCCGCAACAAGCGCATCGCTTACAAGCGCTGCATCACCTG
CCGCCTCAACCTGTGCAACGACTGCCTCAAGGCCTTCCACTCGGATGTGGCCATGCAAGA
CCACGTCTTTGTGGACACCAGCGCCGAGGAACAGGACGAGAAGATCTGCATCCACCACCC
ATCCAGCCGCATCATCGAGTACTGCCGCAATGACAACAAATTGCTCTGCACCTTCTGCAA
GTTCTCTTTCCACAATGGCCACGACACCATTAGCCTCATCGACGCCTGCTCCGAGAGGGC
CGCCTCACTCTTCAGCGCCATCGCCAAGTTCAAAGCAG
gtcctccccttttccactccttcagcctaacttctagttcaggaacacatggggaagatg
gcgtggggtaatctgttaagtgagtgccttaacagattccacctagtggagcaatcaagg
caccaggaaacactgtgctaccctgcaagtcactatcctggtgtccgctcctggcaacca
EXON 3  821 bp
taaggaggaccaaattcatttcataaacctattccagcctgtttcagcccaactacaagt
gccttccctccctcttcattcacctccttggagcctagggtaatttgttctagtttgcta
ctgactttgacacctggggagatgaaaattttaaaagtaactaacttggcatttttgcag
TCCGATATGAAATTGATAATGACCTAATGGAATTCAACATCTTAAAAAACAGCTTTAAAG
CTGACAAGGAGGCAAAGCGAAAAGAGATCAGAAATGGCTTTCTCAAGTTGCGCAGCATTC
TTCAGGAGAAAGAGAAGATCATCATGGAGCAGATAGAGAATCTAGAAGTGTCCAGGCAGA
AGGAAATTGAAAAATATGTGTATGTTACAACCATGAAAGTGAACGAGATGGATGGTCTGA
TCGCCTACTCCAAGGAAGCCCTGAAGGAGACTGGCCAGGTGGCATTCCTGCAGTCAGCCA
AGATCCTGGTGGACCAGATCGAGGACGGCATCCAGACCACCTACAGGCCTGACCCACAGC
TCCGGCTGCACTCAATAAACTACGTGCCCTTGGACTTTGTTGAGCTTTCCAGTGCCATCC
ATGAGCTCTTCCCCACAGGGCCCAAGAAGGTACGCTCCTCAGGGGACTCCCTGCCCTCCC
CCTACCCCGTGCACTCAGAAACAATGATTGCCAGGAAGGTCACTTTCAGCACCCACAGCC
TCGGCAACCAGCACATATACCAGCGAAGCTCCTCCATGTTGTCCTTCAGCAACACTGACA
AGAAGGCCAAGGTGGGTCTGGAGGCCTGTGGGAGAGCCCAGTCAGCCACCCCCGCCAAAC
CCACAGACGGCCTCTACACCTACTGGAGTGCTGGAGCAGACAGCCAGTCTGTACAGAACA
GCAGCAGCTTCCACAACTGGTACTCATTCAACGATGGCTCTGTGAAGACCCCAGGCCCAA
TTGTTATCTACCAGACTCTGGTGTACCCAAGAGCTGCCAAG
gtaagaaaggttctgggcccagtggggaagtgggagggtgtggggcacagagtagaagtg
agtagtcaggaaaggttgcacttacctctttgacctctaggatctggtcactcatatctg
ctcctctagactctttgtggtcatcccattcaaaagggataagctcctggaatcttaagt
EXON 4  225 bp
aggcctcatcacacagtcttccaagacttgtgcatggtctaattaaaagtcttcggtagc
tacaggggatggggtcagcttaaactcaccccacagatagtcaacatcacaaatctttaa
gggaaagaaagctgaatgatgtatactagtaccacaccagtatgttcatttcttccatag
GTTTACTGGACATGTCCAGCAGAAGACGTGGACTCTTTTGAGATGGAATTCTATGAAGTC
ATTACTTCTCCTCCTAACAACGTACAAATGGAGCTCTGTGGACAAATTCGGGACATAATG
CAGCAAAATCTGGAGCTGCACAACCTGACCCCCAACACAGAATACGTGTTTAAAGTTAGA
GCCATCAATGATAATGGTCCTGGGCAATGGAGTGATATCTGCAAG
gtattgtgtgcgttatttctcagacagatttttttttctatggtaggttctggatgaggc
cctgttaagatgatcgtgagattatagaactcactatgggactcttcctctaagcacaga
acatttgttaacttgaggccaaagagagggctgctggcctcaaccagactttgcagatgt
EXON 5  262 bp
ggaaaccttcctggtccttctgagcctcagcttcttcatctataaagtggcaccaacagc
cactgtggtggtcgtgaggagttaatgaaatgatgtgtgtagtgtctgacatgcagaagg
gcccaggctactgggagctgttgtctattgggtgtcatgactcttcgcttctgattgcag
GTGGTAACACCAGATGGACATGGGAAGAACCGAGCTAAGTGGGGCCTGCTGAAGAATATC
CAGTCTGCCCTCCAGAAGCACTTCTGAGCCCCTTCAGAGCAGGAAACAACCTCAGACTCA
TCACAAAGTAGACATATACACACACATATATGTATGTATATTTTTCTCACCACATTCTTC
AAGGAGGTTGTAGACAAATGTTTCCATGACCTCTCAGCTTTCCAACAGGAATCTTGTAAG
AGCTAATAAAAGGAAATACCTG
acatggcttgctgtttgttcaatgacaactatttgttatgatgacagtaataagcaaggc
actcagcaagtctgtatatttccagctgctcaggtctagtcctaggctcagaattctgtg
gtgttttgtaggagcaacacccagcttctaggtggtaaaaagaacactgtattttgcagt