Gene TDGF1 Variant 1
DNA : 4.74 KbNT_022517
mRNA : 2024 bp NM_003212
CDS : 567 bp NP_003203
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  282 bp
ttttttcccaaaagagtacctctgatcattttagcctgcaactaatgatagagatattag
ggctagttaaccacagttttacaagactcctcttcccgcgtgtgggccattgtcatgctg
gtgggcgtcccgcccacctgaaaggtctccccgccccgactggggtttgttgttgaagaa
GGAGAATCCCCGGAAAGGCTGAGTCTCCAGCTCAAGGTCAAAACGTCCAAGGCCGAAAGC
CCTCCAGTTTCCCCTGGACGCCTTGCTCCTGCTTCTGCTACGACCTTCTGGGGAAAACGA
ATTTCTCATTTTCTTCTTAAATTGCCATTTTCGCTTTAGGAGATGAATGTTTTCCTTTGG
CTGTTTTGGCAATGACTCTGAATTAAAGCGATGCTAACGCCTCTTTTCCCCCTAATTGTT
AAAAGCTATGGACTGCAGGAAGATGGCCCGCTTCTCTTACAG
gtatgagctaatcttgaatgtgaactttttttgattgctagagattgccagcttaggaag
taatgttctacacctgtcatttgatttttctcttgctcaagccttaaaagagctgccaac
cgcactgctgtttttcctgaaagacctggaatttcacatggttacttctaactttgccat
EXON 2  53 bp
actttttttcaacatttttctttgttacatgaattagccattaaaaaaagaaagatggtg
ctctacaatttcttttcagtgatctgtggtcttgtccttgtgatgagaggacctgggtgt
taacttgtaaggttttatttcctttgtttggctaactcatgtctgacttcctcttcctag
TGTGATTTGGATCATGGCCATTTCTAAAGTCTTTGAACTGGGATTAGTTGCCG
gtgagagaccttttgttcttttgatcactctcaatttttatgtggcctaaaatacagact
ccatgaattgattttgtcgttaagggctgggccatcaggaatttgctcgtccatctcggg
gatacctggccttcagagatgacagcatttggccccaggaggagcctgcaattcggcctc
EXON 3  135 bp
tttcctttgtttggctaactcatgtctgacttcctcttcctagtgtgatttggatcatgg
ccatttctaaagtctttgaactgggattagttgccggtgagagaccttttgttcttttga
tcactctcaatttttatgtggcctaaaatacagactccatgaattgattttgtcgttaag
GGCTGGGCCATCAGGAATTTGCTCGTCCATCTCGGGGATACCTGGCCTTCAGAGATGACA
GCATTTGGCCCCAGGAGGAGCCTGCAATTCGGCCTCGGTCTTCCCAGCGTGTGCCGCCCA
TGGGGATACAGCACA
gtaagaactgcctgacttcgatgcttctgccctggcccttcatgtgtctcctgagtatct
ttccaacactctttcacctaaaagggcacctggttctggaactgtgcaggtgctggactg
cttttggttttggaagtgagacaaggattgtgtattttacttccctagagtgcagttttc
EXON 4  115 bp
cacttcacactggggaacccagaaccaccactggcctatgcatgaaaatgacttctctgc
tcaaaggcacagagacttactctgatacaacacattggtgttgtattaaccttcgcttac
aggaattgcccttgcacttttccatccctacaccctcagtcatctgttcttacctttcag
GTAAGGAGCTAAACAGAACCTGCTGCCTGAATGGGGGAACCTGCATGCTGGGGTCCTTTT
GTGCCTGCCCTCCCTCCTTCTACGGACGGAACTGTGAGCACGATGTGCGCAAAGA
gtaagcaattcagaggggcggggagccgtggagaggagagagaaagggaagtggaaattt
cagacccaaggctatcgccttacctgttcattctcaggaactgtgggtctgtgccccatg
acacctggctgcccaagaagtgttccctgtgtaaatgctggcacggtcagctccgctgct
EXON 5  110 bp
gggggaacctgcatgctggggtccttttgtgcctgccctccctccttctacggacggaac
tgtgagcacgatgtgcgcaaagagtaagcaattcagaggggcggggagccgtggagagga
gagagaaagggaagtggaaatttcagacccaaggctatcgccttacctgttcattctcag
GAACTGTGGGTCTGTGCCCCATGACACCTGGCTGCCCAAGAAGTGTTCCCTGTGTAAATG
CTGGCACGGTCAGCTCCGCTGCTTTCCTCAGGCATTTCTACCCGGCTGTG
gtaagcggaggttctcctctttcttttgccctttgaagttacgtagttgccttggggggt
gcttagttagcaggctctccttgtacctcttgtcttgctagagcctggcagccaaagttc
tgcttataaaagcatcgcagactcctgatgagatagttgccttggcctctttgatattta
EXON 6  1329 bp
gaatctaaccaggttgtgctcattcctgcaagtgaaggcatcaccactgggctaggttcc
aggtgtgagtgtcctgagaagagcaggttcacagtagcgtatagatatgccacatttgtg
ggcagcaggatgaactgccagagaggtttgctttaatgaccaagcatccctaccttccag
ATGGCCTTGTGATGGATGAGCACCTCGTGGCTTCCAGGACTCCAGAACTACCACCGTCTG
CACGTACTACCACTTTTATGCTAGTTGGCATCTGCCTTTCTATACAAAGCTACTATTAAT
CGACATTGACCTATTTCCAGAAATACAATTTTAGATATCATGCAAATTTCATGACCAGTA
AAGGCTGCTGCTACAATGTCCTAACTGAAAGATGATCATTTGTAGTTGCCTTAAAATAAT
GAATACATTTCCAAAATGGTCTCTAACATTTCCTTACAGAACTACTTCTTACTTCTTTGC
CCTGCCCTCTCCCAAAAAACTACTTCTTTTTTCAAAAGAAAGTCAGCCATATCTCCATTG
TGCCTAAGTCCAGTGTTTCTTTTTTTTTTTTTTTTTGAGACGGAGTCTCACTCTGTCACC
CAGGCTGGACTGCAATGACGCGATCTTGGTTCACTGCAACCTCCGCATCCGGGGTTCAAG
CCATTCTCCTGCCTCAGCCTCCCAAGTAACTGGGATTACAGGCATGTGTCACCATGCCCA
GCTAATTTTTTTGTATTTTTAGTAGAGATGGGGGTTTCACCATATTGGCCAGTCTGGTCT
CGAACTCCTGACCTTGTGATCCACTCGCCTCAGCCTCTCGAAGTGCTGAGATTACACACG
TGAGCAACTGTGCAAGGCCTGGTGTTTCTTGATACATGTAATTCTACCAAGGTCTTCTTA
ATATGTTCTTTTAAATGATTGAATTATATGTTCAGATTATTGGAGACTAATTCTAATGTG
GACCTTAGAATACAGTTTTGAGTAGAGTTGATCAAAATCAATTAAAATAGTCTCTTTAAA
AGGAAAGAAAACATCTTTAAGGGGAGGAACCAGAGTGCTGAAGGAATGGAAGTCCATCTG
CGTGTGTGCAGGGAGACTGGGTAGGAAAGAGGAAGCAAATAGAAGAGAGAGGTTGAAAAA
CAAAATGGGTTACTTGATTGGTGATTAGGTGGTGGTAGAGAAGCAAGTAAAAAGGCTAAA
TGGAAGGGCAAGTTTCCATCATCTATAGAAAGCTATATAAGACAAGAACTCCCCTTTTTT
TCCCAAAGGCATTATAAAAAGAATGAAGCCTCCTTAGAAAAAAAATTATACCTCAATGTC
CCCAACAAGATTGCTTAATAAATTGTGTTTCCTCCAAGCTATTCAATTCTTTTAACTGTT
GTAGAAGACAAAATGTTCACAATATATTTAGTTGTAAACCAAGTGATCAAACTACATATT
GTAAAGCCCATTTTTAAAATACATTGTATATATGTGTATGCACAGTAAAAATGGAAACTA
TATTGACCT
aaatgtgaactggttatttctaggtggtgaggtgctttatggtggtgggtttttgctctt
gatgccctttttgcattttccaaagtaccatggtgaggatgtgttatatcttttccaggg
tcctaaaagtccctggcaactccctccccataccctaccatgactggtcacagaaccctt