Gene SLC35A5 Variant 1
DNA : 22.11 KbNT_005612
mRNA : 2940 bp NM_017945
CDS : 1275 bp NP_060415
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  226 bp
tgtcctcgctttgcttcactcgcgccccttccggcttcccttccttctcactctcttgcc
gtagctgcgccgccaccggggcctcacgtgacactagactctcccggcacgtgacgtgag
aaaggggccgggctggggcgggataagccgcttctcccctccttccggaagcgtaacact
GAACGTGCCTGCGCAATGGGTGTCGGGTCCGCTTTTTCCCAATCCGGACGTAATCGTGGT
TTTTGTTCTGCAATAGGCGGCTTAGAGGGAGGGGCTTTTTCGCCTATACCTACTGTAGCT
TCTCCACGTATGGACCCTAAAGGCTACTGCTGCTACTACGGGGCTAGACAGTTACTGTCT
CAGCTCTAGGATGTGCGTTCTTCCACTAGAAGCTCTTCTGAGGGAG
gtaaccgcgccccgcgggcaaggaattgcgcctgcgtctgaggggagggtgcgccagtga
agagccctactgcgcatgtgtgactagaagggtagtccctgactgtgaagggaaatctgg
ccccctcctgtcggggaggcgtcctgtaggcgtgcgcccaatggggctgtcagtattggc
EXON 2  149 bp
tccctcttatcagattttcactttccttttgtcatagtttctttatgcctcaactttctt
ggtgctgatatagtcatagccaaaattttttaaaaattccttttttgtcctcacgatcaa
tggtatttgcgtttagggtctgccaacaaggtcgttcatgaaagtgtttttctctttaag
GTAATTAAAAAACAGTGGAATGGAAAAACAGTGCTGTAGTCATCCTGTAATATGCTCCTT
GTCAACAATGTATACATTCCTGCTAGGTGCCATATTCATTGCTTTAAGCTCAAGTCGCAT
CTTACTAGTGAAGTATTCTGCCAATGAAG
gtaagttaagacttggtatatgcatggagcacttccatctaatcacacatctctctcttg
cctttggttctgttatatataacatggaaataataatgccttttgcttcatgtgagtgat
aaagcatatttaaatttgattatttaaccttgcattcctcaacaagaaaaaatgtttgat
EXON 3  99 bp
ggatagctaatacattaggtgaattgattaaaaaatccaaaggagcaaaggcaactggaa
gaaacttaatataaccagtagtaaatccagcttttaaattttaaaacaattatgttatac
tgtatataaacatacatggaataaaatatatagttaaaaaacatttctgttacatttcag
AAAACAAGTATGATTATCTTCCAACTACTGTGAATGTGTGCTCAGAACTGGTGAAGCTAG
TTTTCTGTGTGCTTGTGTCATTCTGTGTTATAAAGAAAG
gtaagtcttgaaatggtactatatacttgttaatcataggaccaaaaaatgttagaactg
gaaggaacattttgtatcatttagcttagtccattaaattttatatgaggaagctaagat
acaaacataagtatgttttagaggtggagaaacaagctcaaagagaaagtgttaatgcag
EXON 4  131 bp
cctaaggttgttgctgattgtcagtgatgaaactggtgggttgaagagagacagtaatga
aatggaggcacgtttataaagctccctttaaagaattgtatcagtaatcaagtgcagtgt
aatttctctaaaaatgtgggcattctcatcaaggtcatttacaccgtgtttctttctaag
ATCATCAAAGTAGAAATTTGAAATATGCTTCCTGGAAGGAATTCTCTGATTTCATGAAGT
GGTCCATTCCTGCCTTTCTTTATTTCCTGGATAACTTGATTGTCTTCTATGTCCTGTCCT
ATCTTCAACCA
gtaagtaaatatgaaaaagaaaataccattgaaaagatacagagaaataaatcccagaat
ttttttttttttatcatttttgttggcattgttagtttctcattgtcctcactggccttc
ctgagatttccccagaattatctgagtcctgaattatcaatatgcgtgccaggttctctt
EXON 5  68 bp
atctacgtaaatttgacaagcgacaaaactggaatttaatccttagttgaaattgctacc
ttaataacccctctgttttttgaccaaaaagctttttttgtcaggtgaactgccaagcta
agacatttctgaggtcagtacttcatttggattgtaactctatcttctctttctttctag
GCCATGGCTGTTATCTTCTCAAATTTTAGCATTATAACAACAGCTCTTCTATTCAGGATA
GTGCTGAA
gtaagtaacttgctgtgaaaacatatatcatactttaaaataacatagcccggtttcaaa
tgatatacccagaacactgagccgtcagaatcccaaagccaggattttgttcctaattga
ctttgtgtactgggcacgtttaagccatgtagaaagcagctccagtgctagtccatctaa
EXON 6  781 bp
aaaacattaaatttgagagacaggcaccaacagtttttctctgaacttgagtggtaggaa
atgctagcaaaaactgggtccagtttattcaaccaaatactcaagtgtctgagttttcag
tagaaactattgatatggggggaaaacagtagtaaaatcttttttttcatctttgaacag
GAGGCGTCTAAACTGGATCCAGTGGGCTTCCCTCCTGACTTTATTTTTGTCTATTGTGGC
CTTGACTGCCGGGACTAAAACTTTACAGCACAACTTGGCAGGACGTGGATTTCATCACGA
TGCCTTTTTCAGCCCTTCCAATTCCTGCCTTCTTTTCAGAAGTGAGTGTCCCAGAAAAGA
CAATTGTACAGCAAAGGAATGGACTTTTCCTGAAGCTAAATGGAACACCACAGCCAGAGT
TTTCAGTCACATCCGTCTTGGCATGGGCCATGTTCTTATTATAGTCCAGTGTTTTATTTC
TTCAATGGCTAATATCTATAATGAAAAGATACTGAAGGAAGGGAACCAGCTCACTGAAAG
CATCTTCATACAGAACAGCAAACTCTATTTCTTTGGCATTCTGTTTAATGGGCTGACTCT
GGGCCTTCAGAGGAGTAACCGTGATCAGATTAAGAACTGTGGATTTTTTTATGGCCACAG
TGCATTTTCAGTAGCCCTTATTTTTGTAACTGCATTCCAGGGCCTTTCAGTGGCTTTCAT
TCTGAAGTTCCTGGATAACATGTTCCATGTCTTGATGGCCCAGGTTACCACTGTCATTAT
CACAACAGTGTCTGTCCTGGTCTTTGACTTCAGGCCCTCCCTGGAATTTTTCTTGGAAGC
CCCATCAGTCCTTCTCTCTATATTTATTTATAATGCCAGCAAGCCTCAAGTTCCGGAATA
CGCACCTAGGCAAGAAAGGATCCGAGATCTAAGTGGCAATCTTTGGGAGCGTTCCAGTGG
G
gtaagtttgtgagggtgttcctttttgcttgttcttcccaaatttaaagcatagttaatt
caaggaaaaaaataaaatcagtactgatttgtcaaagaatgtattggatctctgactttt
aaaaccgaatcaacaaacattccttttactcctgatgtttgcaagggctcataatcaatg
EXON 7  1486 bp
ttttttatcctctcatacttctatagttaactttccaagaacataagtatttatttaatt
tgaccagattatatctatagcttaatgaggtaagaccagtgatttgttagtaaggttttc
cctttaaaaatgctacatttccagttttgttctaattactgctttcatgtttccttttag
GATGGAGAAGAACTAGAAAGACTTACCAAACCCAAGAGTGATGAGTCAGATGAAGATACT
TTCTAACTGGTACCCACATAGTTTGCAGCTCTCTTGAACCTTATTTTCACATTTTCAGTG
TTTGTAATATTTATCTTTTCACTTTGATAAACCAGAAATGTTTCTAAATCCTAATATTCT
TTGCATATATCTAGCTACTCCCTAAATGGTTCCATCCAAGGCTTAGAGTACCCAAAGGCT
AAGAAATTCTAAAGAACTGATACAGGAGTAACAATATGAAGAATTCATTAATATCTCAGT
ACTTGATAAATCAGAAAGTTATATGTGCAGATTATTTTCCTTGGCCTTCAAGCTTCCAAA
AAACTTGTAATAATCATGTTAGCTATAGCTTGTATATACACATAGAGATCAATTTGCCAA
ATATTCACAATCATGTAGTTCTAGTTTACATGCCAAAGTCTTCCCTTTTTAACATTATAA
AAGCTAGGTTGTCTCTTGAATTTTGAGGCCCTAGAGATAGTCATTTTGCAAGTAAAGAGC
AACGGGACCCTTTCTAAAAACGTTGGTTGAAGGACCTAAATACCTGGCCATACCATAGAT
TTGGGATGATGTAGTCTGTGCTAAATATTTTGCTGAAGAAGCAGTTTCTCAGACACAACA
TCTCAGAATTTTAATTTTTAGAAATTCATGGGAAATTGGATTTTTGTAATAATCTTTTGA
TGTTTTAAACATTGGTTCCCTAGTCACCATAGTTACCACTTGTATTTTAAGTCATTTAAA
CAAGCCACGGTGGGGCTTTTTTCTCCTCAGTTTGAGGAGAAAAATCTTGATGTCATTACT
CCTGAATTATTACATTTTGGAGAATAAGAGGGCATTTTATTTTATTAGTTACTAATTCAA
GCTGTGACTATTGTATATCTTTCCAAGAGTTGAAATGCTGGCTTCAGAATCATACCAGAT
TGTCAGTGAAGCTGATGCCTAGGAACTTTTAAAGGGATCCTTTCAAAAGGATCACTTAGC
AAACACATGTTGACTTTTAACTGATGTATGAATATTAATACTCTAAAAATAGAAAGACCA
GTAATATATAAGTCACTTTACAGTGCTACTTCACACTTAAAAGTGCATGGTATTTTTCAT
GGTATTTTGCATGCAGCCAGTTAACTCTCGTAGATAGAGAAGTCAGGTGATAGATGATAT
TAAAAATTAGCAAACAAAAGTGACTTGCTCAGGGTCATGCAGCTGGGTGATGATAGAAGA
GTGGGCTTTAACTGGCAGGCCTGTATGTTTACAGACTACCATACTGTAAATATGAGCTTT
ATGGTGTCATTCTCAGAAACTTACACATTTCTGCTCTCCTTTCTCCTAAGTTTCATGCAG
ATGAATATAAGGTAATATACTATTATATAATTCATTTGTGATATCCACAATAATATGACT
GGCAAGAATTGGTGGAAATTTGTAATTAAAATAATTATTAAACCTA
tgtcttgtgttgccactctgtcatttagggtgggatgtagagtacttttaatcttaaaaa
atagagtgagacaaaaacctacacaacttttaaaactttctctttaagtagatctttact
tctaacaataacaaaggcattttcatcagttatgtgaaatacgaagattatatctattat