Gene SLC2A2 Variant 1
DNA : 30.63 KbNT_005612
mRNA : 3439 bp NM_000340
CDS : 1575 bp NP_000331
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  324 bp
tctaaacagaaacaccacagcactaattatctgtggagcagagtgcagtgtgcctcccat
gctccacagcacagcacggcagctcagcatatctcatcttctacaaaagactccaaagat
ttctcttttcaccagctcccaattactgccacataacacatgccttgaaatgtgattgcc
TCTGGTTTGTAACTTATGCCTAAGGGACCTGCTCCCATTTTCTTTCCTAGTGGAACAAAG
GTATTGAAGCCACAGGTTGCTGAGGCAAAGCACTTATTGATTAGATTCCCATCAATATTC
AGCTGCCGCTGAGAAGATTAGACTTGGACTCTCAGGTCTGGGTAGCCCAACTCCTCCCTC
TCCTTGCTCCTCCTCCTGCAATGCATAACTAGGCCTAGGCAGAGCTGCGAATAAACAGGC
AGGAGCTAGTCAGGTGCATGTGCCACACTCACACAAGACCTGGAATTGACAGGACTCCCA
ACTAGTACAATGACAGAAGATAAG
gtaaagcagcattatattcatttcaagtctggttttcaggagatagttaggggaatacag
tcaagtcatacagaggatttgggggaggttgggtgtagctaccacagatcaaaattaatt
ctctttactttgccaattgaagaactgtttcttattcagtaattggggttttaaggattt
EXON 2  93 bp
ggctcacattcttgtatgaacaacacctgccagcctggagcacagggcatactgcaaatc
gatattgaggggaaagaaccagcctgtggagcctgtaagaagtttaagctgcagcctgac
agaaagatgggaaactaaaattgcctggtgtttccctgccctgtgtctcgccccctgcag
GTCACTGGGACCCTGGTTTTCACTGTCATCACTGCTGTGCTGGGTTCCTTCCAGTTTGGA
TATGACATTGGTGTGATCAATGCACCTCAACAG
gcaagtgaaatatgtagaagttctctttttggcaagttctgtcagtgatagatatcatat
gttcctcatacacagagataaagggtgtccacgtgggagacacaaggccatcctggcctg
tcaggtacgatgtgcactgttccaaagctgataacttggccttgactccctaattaacaa
EXON 3  263 bp
aatttataacctttcttttataggatatggccaactgtaaacaaatctatccatgtttat
atgtatataaaacacataattgagatggtactatttaaacacgtaacaaacactttaaag
acaaaaacaaaaatacatagaatgtttgaaatagtaaagctatttttctttatctcctag
GTAATAATATCTCACTATAGACATGTTTTGGGTGTTCCACTGGATGACCGAAAAGCTATC
AACAACTATGTTATCAACAGTACAGATGAACTGCCCACAATCTCATACTCAATGAACCCA
AAACCAACCCCTTGGGCTGAGGAAGAGACTGTGGCAGCTGCTCAACTAATCACCATGCTC
TGGTCCCTGTCTGTATCCAGCTTTGCAGTTGGTGGAATGACTGCATCATTCTTTGGTGGG
TGGCTTGGGGACACACTTGGAAG
gtaggcaaatttcataaataagcataaacagaaactttcatattttcattttcctaacac
ttgtttagaaaaatattatctttcttcttgtggaatagctttagagttgttttttcaact
catgaccctatgaggcatatcagtgttagatcaaatcaatgaaaaaagctgttgcgacag
EXON 4  125 bp
atactttagtccatagatgagtcaaattagcaatcttggttcaagattccccaactagct
tttacagcaaaattaaaataattgctcttaggttaaaaaaaatctcaacatgctctgaaa
gcgaataattttagcaagttttgatgctgaatttatattccttgctttttaaaatttcag
AATCAAAGCCATGTTAGTAGCAAACATTCTGTCATTAGTTGGAGCTCTCTTGATGGGGTT
TTCAAAATTGGGACCATCTCATATACTTATAATTGCTGGAAGAAGCATATCAGGACTATA
TTGTG
gtaagtcacacacacacacacacacacacacacacacacacacacctacctttgtctgaa
agtaactctaaaggcggatgtggtagcactcagggatatttttgagtctagggtgacatc
acagagggaaaggcaatagcataaagttgaaatcctgagttgggaggtttgggaccagta
EXON 5  116 bp
tatgaggtcatatcaaatatctcctgcacaaactatgtctatacctaggaacaagggttc
atccttccagtgaattcagggaggggctttcattcaagatatatactgtacttaaaccaa
attgttattattgagatagtcctggttgcactttaacatttatgtttatgtttcatgcag
GGCTAATTTCAGGCCTGGTTCCTATGTATATCGGTGAAATTGCTCCAACCGCTCTCAGGG
GAGCACTTGGCACTTTTCATCAGCTGGCCATCGTCACGGGCATTCTTATTAGTCAG
gtaaaaactccccatccttatcccctactgcacccatctacttcatcctctacagtacca
ctactactattgcatcccctactgtacttcctccacttcatccatctcgtccctccctga
ctgtccattctcactgtagaccagcacagagagaaaagccaattctaccagtggtagtgg
EXON 6  163 bp
tataacaaatagttcctaatttagttaaagtgagatacaatagtaacagtttccgttttt
acttgaaccaaagttgtcagagactactattaaatagccaaagtactttttcaacaaact
agtgtaaaaggtagatccaaagtattatgtagttgatatacttcctccttgcattttcag
ATTATTGGTCTTGAATTTATCTTGGGCAATTATGATCTGTGGCACATCCTGCTTGGCCTG
TCTGGTGTGCGAGCCATCCTTCAGTCTCTGCTACTCTTTTTCTGTCCAGAAAGCCCCAGA
TACCTTTACATCAAGTTAGATGAGGAAGTCAAAGCAAAACAAA
gtaagtctgtggatggtttttctttcttcctattgttttggcattatcagctaatgtaaa
acagtgctttccacatgaagttggtgattaaatgtaagaagaatgtgcaaaatcgctttt
atatgactggtgcatgtcatttggcacccataggcattcacttaagccgaaaccagaaat
EXON 7  188 bp
gttctatttttcttttaaatcaaagagcaggatctaatttaacaaaaaaagaatttccaa
cacccatgctattaagtaatacaatggggcatgcagaaatgtagctctttcattaacata
aaaataaatttctttttgttttggcctgagttgtttcaacctgatcattttcttggacag
GCTTGAAAAGACTCAGAGGATATGATGATGTCACCAAAGATATTAATGAAATGAGAAAAG
AAAGAGAAGAAGCATCGAGTGAGCAGAAAGTCTCTATAATTCAGCTCTTCACCAATTCCA
GCTACCGACAGCCTATTCTAGTGGCACTGATGCTGCATGTGGCTCAGCAATTTTCCGGAA
TCAATGGC
gtaagtttaagaacacccactaactcttaagagcacagtgaattaaaatagggaaggcaa
ggggtacaagtttaaatagctaaaagatattttaaggtattggcatcatgggtcttgcta
taacaaacgtacattgagtaagcattaatttccattttgcttcaaaagttttctaaaatt
EXON 8  105 bp
ctttaaacactaaaggaagactgagggttctcttccttggaaggagaaaatctgtacgaa
gttctagggtgcatgccgctatagaaacaactaaaaataaacaatctaaaatatttcttg
ctttaaagatatcagtgccagacttcttaagattaaggctaacctgtttttactttgcag
ATTTTTTACTACTCAACCAGCATTTTTCAGACGGCTGGTATCAGCAAACCTGTTTATGCA
ACCATTGGAGTTGGCGCTGTAAACATGGTTTTCACTGCTGTCTCT
gtaagtcaatgccctagataaatactctgcttgttccttagtccagaaattgcaggaggg
gtggggaacttcggctctaaaagcaatcaatgacttattgtacacatgctctaagtgtgt
aaacccaagtgagtcatgagaagagtcctgtttgaataagccaaccactgcattgagatt
EXON 9  102 bp
gccacctggggctagagtcactccccaccttgatctcactcctgtaaaatggaaggatgg
aattgcctcttatctgttatataaattaaaatgacctctttggcagtaaaaatgatttaa
gtaaacagtcaatattttgtgactcacaaaactgagataatttctttaaaattgtcctag
GTATTCCTTGTGGAGAAGGCAGGGCGACGTTCTCTCTTTCTAATTGGAATGAGTGGGATG
TTTGTTTGTGCCATCTTCATGTCAGTGGGACTTGTGCTGCTG
gtaagtttggtgcctgcactgaggtttttcattaacatatgatggtacctggcacctctg
tggtccaggttaaagtgctttgtattcaaaaatatttgagactgacttacgaaataaagc
cagagcaacagcataaaatcaaaggagatatataaagaaaagatgaactagtttcttggg
EXON 10  204 bp
aaagagttatgcatgattcagactagaataatttctctcagaatagaataacttatactt
gcttgaacaaaatacattagaaaaagttgtatgccgcctgtgaactcagaggctacttag
ctaaaggaaaaagcagccaaatgatctcagtcccactattgtttttgtttttttcctcag
AATAAGTTCTCTTGGATGAGTTATGTGAGCATGATAGCCATCTTCCTCTTTGTCAGCTTC
TTTGAAATTGGGCCAGGCCCGATCCCCTGGTTCATGGTGGCTGAGTTTTTCAGTCAAGGA
CCACGTCCTGCTGCTTTAGCAATAGCTGCATTCAGCAATTGGACCTGCAATTTCATTGTA
GCTCTGTGTTTCCAGTACATTGCG
gtaagcagcctaatattccacagatttactgaacagaagagagggtcaaaaaactgctaa
ctcaaagtctgtgtttgctttctatccaggacttctgtggaccttatgtgtttttcctct
ttgctggagtgctcctggcctttaccctgttcacattttttaaagttccagaaaccaaag
EXON 11  1756 bp
tcaaggaccacgtcctgctgctttagcaatagctgcattcagcaattggacctgcaattt
cattgtagctctgtgtttccagtacattgcggtaagcagcctaatattccacagatttac
tgaacagaagagagggtcaaaaaactgctaactcaaagtctgtgtttgctttctatccag
GACTTCTGTGGACCTTATGTGTTTTTCCTCTTTGCTGGAGTGCTCCTGGCCTTTACCCTG
TTCACATTTTTTAAAGTTCCAGAAACCAAAGGAAAGTCTTTTGAGGAAATTGCTGCAGAA
TTCCAAAAGAAGAGTGGCTCAGCCCACAGGCCAAAAGCTGCTGTAGAAATGAAATTCCTA
GGAGCTACAGAGACTGTGTAAAAAAAAAACCCTGCTTTTTGACATGAACAGAAACAATAA
GGGAACCGTCTGTTTTTAAATGATGATTCCTTGAGCATTTTATATCCACATCTTTAAGTA
TTGTTTTATTTTTATGTGCTCTCATCAGAAATGTCATCAAATATTACCAAAAAAGTATTT
TTTTAAGTTAGAGAATATATTTTTGATGGTAAGACTGTAATTAAGTAAACCAAAAAGGCT
AGTTTATTTTGTTACACTAAAGGGCAGGTGGTTCTAATATTTTTAGCTCTGTTCTTTATA
ACAAGGTTCTTCTAAAATTGAAGAGATTTCAACATATCATTTTTTTAACACATAACTAGA
AACCTGAGGATGCAACAAATATTTATATATTTGAATATCATTAAATTGGAATTTTCTTAC
CCATATATCTTATGTTAAAGGAGATATGGCTAGTGGCAATAAGTTCCATGTTAAAATAGA
CAACTCTTCCATTTATTGCACTCAGCTTTTTTCTTGAGTACTAGAATTTGTATTTTGCTT
AAAATTTTACTTTTGTTCTGTATTTTCATGTGGAATGGATTATAGAGTATACTAAAAAAT
GTCTATAGAGAAAAACTTTCATTTTTGGTAGGCTTATCAAAATCTTTCAGCACTCAGAAA
AGAAAACCATTTTAGTTCCTTTATTTAATGGCCAAATGGTTTTTGCAAGATTTAACACTA
AAAAGGTTTCACCTGATCATATAGCGTGGGTTATCAGTTAACATTAACATCTATTATAAA
ACCATGTTGATTCCCTTCTGGTACAATCCTTTGAGTTATAGTTTGCTTTGCTTTTTAATT
GAGGACAGCCTGGTTTTCACATACACTCAAACAATCATGAGTCAGACATTTGGTATATTA
CCTCAAATTCCTAATAAGTTTGATCAAATCTAATGTAAGAAAATTTGAAGTAAAGGATTG
ATCACTTTGTTAAAAATATTTTCTGAATTATTATGTCTCAAAATAAGTTGAAAAGGTAGG
GTTTGAGGATTCCTGAGTGTGGGCTTCTGAAACTTCATAAATGTTCAGCTTCAGACTTTT
ATCAAAATCCCTATTTAATTTTCCTGGAAAGACTGATTGTTTTATGGTGTGTTCCTAACA
TAAAATAATCGTCTCCTTTGACATTTCCTTCTTTGTCTTAGCTGTATACAGATTCTAGCC
AAACTATTCTATGGCCATTACTAACACGCATTGTACACTATCTATCTGCCTTTACCTACA
TAGGCAAATTGGAAATACACAGATGATTAAACAGACTTTAGCTTACAGTCAATTTTACAA
TTATGGAAATATAGTTCTGATGGGTCCCAAAAGCTTAGCAGGGTGCTAACGTATCTCTAG
GCTGTTTTCTCCACCAACTGGAGCACTGATCAATCCTTCTTATGTTTGCTTTAATGTGTA
TTGAAGAAAAGCACTTTTTAAAAAGTACTCTTTAAGAGTGAAATAATTAAAAACCACTGA
ACATTTGCTTTGTTTTCTAAAGTTGTTCACATATATGTAATTTAGCAGTCCAAAGAACAA
GAAATTGTTTCTTTTC
agtgtgatttgtttttcatttgggccaatttgggataaactattttcacttgggatttca
ggatacagtcaaaataagcttaaataactcaggacatctttgtgctaaactgtgaactct
ggacaaaaatagagagtctctgaatagggcaggagcaggaaaatggctcctgggtggctc