Gene QARS Variant 1
DNA : 8.81 KbNT_022517
mRNA : 2429 bp NM_005051
CDS : 2328 bp NP_005042
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  122 bp
ggaaaggccggtttgtccgccctgtgttgtttaaaggggatagacgaccttggagcgccc
cgccccctcccgccaaggaaggaccccattggctctccccggaggcttcactctcattgg
tcagcgagtgaatgccgacctgcagactggggcctaagtttcttttagtttccggtgtct
CTGCAATGGCGGCTCTAGACTCCCTGTCGCTCTTCACTAGCCTCGGCCTGAGCGAGCAGA
AGGCCCGCGAGACGCTCAAGAACTCGGCTCTGAGCGCGCAGCTGCGCGAGGCCGCTACTC
AG
gtgcgagcccctctgcccccggcctggtttgcagaccatgctgcaacgcagcgcggggcg
gggtccagatcccgacctgccccgtttgtcccgccctttcctctcactgagcgcggggct
tctctcttgacccctctgacctcaggctcagcagaccctgggttccaccattgacaaagc
EXON 2  148 bp
ctctgagcgcgcagctgcgcgaggccgctactcaggtgcgagcccctctgcccccggcct
ggtttgcagaccatgctgcaacgcagcgcggggcggggtccagatcccgacctgccccgt
ttgtcccgccctttcctctcactgagcgcggggcttctctcttgacccctctgacctcag
GCTCAGCAGACCCTGGGTTCCACCATTGACAAAGCTACCGGGATCCTGTTATATGGCTTG
GCCTCCCGACTCAGGGATACCCGGCGTCTCTCCTTCCTTGTAAGCTACATAGCCAGTAAG
AAGATCCACACTGAGCCCCAGCTAAGCG
gtgagacccctacctgtcctgccagttcgcaccaatgcctcccttcagccaagacccctg
tcttccctttttgccaagtcctccagtttctttctagacacctagttctgcacaggcact
gaggcatggaaggggtggcctatggtgagactgacacgggaactgtcagggtctgagggg
EXON 3  110 bp
tctgaggggggatccactctcgacacgtgcttctttcttccctgtgttctctagggtggt
ggtgccagggcttaacttttcaggaggccagactatccttggagtttcatgagattagga
ccctgtctgtccacttcttggagcagagatgccacaaactcacgggctctttcttctcag
CTGCCCTTGAGTATGTGCGGAGTCACCCCTTGGACCCCATCGACACTGTGGACTTCGAGC
GGGAATGTGGCGTGGGTGTCATTGTGACCCCAGAGCAGATTGAGGAGGCT
gtgagtctttccccaggcatcgtctgcctccccagtcctggccatggaaaggagtggctc
agtttccctcctcaggaagacccagagtgagggtgtgggttcccagaatatctctaaagg
tggctttcctgaaccacatggtttggctttctgcaggtggaggctgctattaacaggcac
EXON 4  76 bp
accccagagcagattgaggaggctgtgagtctttccccaggcatcgtctgcctccccagt
cctggccatggaaaggagtggctcagtttccctcctcaggaagacccagagtgagggtgt
gggttcccagaatatctctaaaggtggctttcctgaaccacatggtttggctttctgcag
GTGGAGGCTGCTATTAACAGGCACCGGCCCCAGCTCCTGGTGGAACGTTACCATTTCAAC
ATGGGGCTGCTGATGG
gtgagcagggcctggaacggggctatattgttctctctggtcatgccttttcttctgggc
acgagtgagaaggaggtgggggaaggaacaggagtgacttaaagtggtctggctgggctc
aggctctggttctggtggtcagccaggacctttccttgggaaagaggtggggggagtact
EXON 5  65 bp
catgccttttcttctgggcacgagtgagaaggaggtgggggaaggaacaggagtgactta
aagtggtctggctgggctcaggctctggttctggtggtcagccaggacctttccttggga
aagaggtggggggagtactcttttttgcctttctgcagctccttgtgcctatgcttctag
GAGAGGCTCGGGCTGTGCTGAAGTGGGCAGATGGCAAAATGATCAAGAATGAAGTGGACA
TGCAG
gtgagcgtgcttcactaagctgaagctggcaaagactctggcatgaacagagcctggaat
ccactaagggataaaaggcaggaagagggctgggcatggtggctcacgcttctgatccca
gcactttgggaggctgaggcaggaggattacttgagcccaggagttcaagaccagcctga
EXON 6  54 bp
caagagcaagagcattttaagctagcagacccacatgagaagagatgggatgggctaggt
aggttttttcagtcagtgctggtagataggccaggaagccttgggttggtgggtaggatc
agtcaggggctccttgaaagaggatactcctgcctctgcctgattctggtctctgctcag
GTCCTCCACCTTCTGGGCCCCAAGTTGGAGGCTGATCTGGAGAAGAAGTTCAAG
gtagggatgggcatggccctgagtccctgagggtgaggtgaggtatggtgagacttcagg
ctggggaaggaagtgtctgaccacagggatcccaagaccctatccaagagaaaatttgat
gccattttctgaagcacctggggcttctttcaggtggcaaaagctcggctagaagaaaca
EXON 7  61 bp
gaggctgatctggagaagaagttcaaggtagggatgggcatggccctgagtccctgaggg
tgaggtgaggtatggtgagacttcaggctggggaaggaagtgtctgaccacagggatccc
aagaccctatccaagagaaaatttgatgccattttctgaagcacctggggcttctttcag
GTGGCAAAAGCTCGGCTAGAAGAAACAGACCGGAGGACGGCAAAGGATGTGGTGGAGAAT
G
gtgagaagcttgagactcctgtcacagcattcagctccctgacttctgaacctcctcaga
agagtccttacaggctcctcaggcccttggcttactcagtaccctgacttctgtctcaag
actgggattcctggtgtttcttttgttccctttgcccagagactggcatgagaggcctca
EXON 8  72 bp
gattcctggtgtttcttttgttccctttgcccagagactggcatgagaggcctcagatgt
ctggctctagatatcttgtctctggaattgagggaataggggtctactcagttctgttct
ggctgtaggatatggtaaatgtatctagaggacaagttttccttgttttgttccccacag
GCGAGACTGCTGACCAGACCCTGTCTCTGATGGAGCAGCTCCGGGGGGAGGCCCTTAAGT
TCCACAAGCCTG
gttagtgggcatgtcaaaaccctggggagggctggatcttggcagcagctcctatagtca
ggcccctggggtcagaggctttggctgcagcctggtccttaggcttattctggtcctggc
aggtgagaactacaagaccccaggctatgtggtcactccacacaccatgaatctactaaa
EXON 9  86 bp
cagaccctgtctctgatggagcagctccggggggaggcccttaagttccacaagcctggt
tagtgggcatgtcaaaaccctggggagggctggatcttggcagcagctcctatagtcagg
cccctggggtcagaggctttggctgcagcctggtccttaggcttattctggtcctggcag
GTGAGAACTACAAGACCCCAGGCTATGTGGTCACTCCACACACCATGAATCTACTAAAGC
AGCACCTGGAGATTACTGGTGGGCAG
gtgtgtggggatgtggccatgtgagcttgtgccatcaaacacctgcctgagtgcctgggc
tgcgtccatactgccccatctcacccatcaccatggccttcctgggagggaacatctgtt
tctttaaggtcatctgagctcagactttatttctcttttcccatcccccttattttaggt
EXON 10  87 bp
aggtgtgtggggatgtggccatgtgagcttgtgccatcaaacacctgcctgagtgcctgg
gctgcgtccatactgccccatctcacccatcaccatggccttcctgggagggaacatctg
tttctttaaggtcatctgagctcagactttatttctcttttcccatcccccttattttag
GTACGTACCCGGTTCCCGCCAGAACCCAATGGAATCCTGCATATTGGACATGCCAAAGCC
ATCAATTTCAACTTTGGCTATGCCAAG
gtaagcatgtgtctagggacctggcaagcaagatgaccacttgctgttcccatgagtgga
taccatatccctgccttgctgtctgctcccaataatgtacccaggtgggcagaggccatg
gaaaggaaccacatgtgtgacagatacctaggaatctattgagcttattggaataaatag
EXON 11  100 bp
aggagaaacccaggaggtggaggctgcagtgagccaagatggtgcaagataatcaagact
ccatctcaaaaaaaaagaaaattctgacatgagagtgctctgtgaatatcctagtttgat
aaacaggattgtggggctgatggatgatgtgggagttcacagatggtgcaactttcctag
GCCAACAATGGCATCTGTTTTCTGCGTTTTGATGACACCAACCCTGAGAAGGAGGAAGCA
AAGTTCTTCACGGCCATCTGTGACATGGTAGCCTGGCTAG
gtatggactaggcaaagcctagaagggctggtggttagtgggcctctccttgggccatgg
cctgcccactgggtgtttgtggctggctgctcatactttgtttcattttgccccaggcta
cacaccttacaaagtcacatatgcgtctgactattttgaccagctatatgcgtgggctgt
EXON 12  79 bp
accaaccctgagaaggaggaagcaaagttcttcacggccatctgtgacatggtagcctgg
ctaggtatggactaggcaaagcctagaagggctggtggttagtgggcctctccttgggcc
atggcctgcccactgggtgtttgtggctggctgctcatactttgtttcattttgccccag
GCTACACACCTTACAAAGTCACATATGCGTCTGACTATTTTGACCAGCTATATGCGTGGG
CTGTGGAGCTCATCCGCAG
gtaaggccagggccatgacgtagagccaggcagactgactaggtcacagccatgctgggc
actcacaccgcttccccacaggggtctggcttatgtgtgccaccagcgaggagaggagct
caaaggccataatactctgccttcaccctggagagaccgtcccatggaggagtcactgct
EXON 13  109 bp
tttgtttcattttgccccaggctacacaccttacaaagtcacatatgcgtctgactattt
tgaccagctatatgcgtgggctgtggagctcatccgcaggtaaggccagggccatgacgt
agagccaggcagactgactaggtcacagccatgctgggcactcacaccgcttccccacag
GGGTCTGGCTTATGTGTGCCACCAGCGAGGAGAGGAGCTCAAAGGCCATAATACTCTGCC
TTCACCCTGGAGAGACCGTCCCATGGAGGAGTCACTGCTGCTCTTTGAG
gtggggtcctagaggagcatctgggtttgggtgggccaaggtgctgagaatgagatgctc
ctgtgcttagagacagcctgagtccttgttcccctcaggcaatgcgcaagggcaagtttt
cagagggcgaggccacactacggatgaagctggtgatggaggatggcaagatggaccctg
EXON 14  131 bp
aggagaggagctcaaaggccataatactctgccttcaccctggagagaccgtcccatgga
ggagtcactgctgctctttgaggtggggtcctagaggagcatctgggtttgggtgggcca
aggtgctgagaatgagatgctcctgtgcttagagacagcctgagtccttgttcccctcag
GCAATGCGCAAGGGCAAGTTTTCAGAGGGCGAGGCCACACTACGGATGAAGCTGGTGATG
GAGGATGGCAAGATGGACCCTGTAGCCTATCGAGTCAAGTATACACCACACCACCGCACA
GGGGACAAATG
gtgggtgtagaatggggtggggtggtggggctgccgagcagggcgatgggccatggggta
gggcagagtagggctggatggtagggcccactgcctatgccccacaggtgcatctatccc
acctacgactacacacactgcctctgtgactccatcgagcacatcactcactcactctgc
EXON 15  93 bp
tggaggatggcaagatggaccctgtagcctatcgagtcaagtatacaccacaccaccgca
caggggacaaatggtgggtgtagaatggggtggggtggtggggctgccgagcagggcgat
gggccatggggtagggcagagtagggctggatggtagggcccactgcctatgccccacag
GTGCATCTATCCCACCTACGACTACACACACTGCCTCTGTGACTCCATCGAGCACATCAC
TCACTCACTCTGCACCAAGGAATTCCAGGCCCG
gtgagggagctgggtccatggggtggtagggccagtggaattccagcagcccttcctgtg
gtctctgcctggttccagagctggccagtgctaaccctactctcccaccccagacgctct
tcctacttctggctttgcaatgcactggacgtctattgccctgtgcagtgggagtatggc
EXON 16  138 bp
cacactgcctctgtgactccatcgagcacatcactcactcactctgcaccaaggaattcc
aggcccggtgagggagctgggtccatggggtggtagggccagtggaattccagcagccct
tcctgtggtctctgcctggttccagagctggccagtgctaaccctactctcccaccccag
ACGCTCTTCCTACTTCTGGCTTTGCAATGCACTGGACGTCTATTGCCCTGTGCAGTGGGA
GTATGGCCGCCTCAACCTGCACTATGCTGTTGTCTCTAAGAGGAAGATCCTCCAGCTTGT
AGCAACTGGTGCTGTGCG
gtaggtgcggctgtttggcttatgaaaggttaatggcatatgctcccaaaggccttctca
ccaccttcttatccacagggactgggatgacccacggctctttacactcacggccctgcg
acggcggggcttcccacctgaggccatcaacaacttctgtgcccgggtatagcccagcag
EXON 17  88 bp
cgtctattgccctgtgcagtgggagtatggccgcctcaacctgcactatgctgttgtctc
taagaggaagatcctccagcttgtagcaactggtgctgtgcggtaggtgcggctgtttgg
cttatgaaaggttaatggcatatgctcccaaaggccttctcaccaccttcttatccacag
GGACTGGGATGACCCACGGCTCTTTACACTCACGGCCCTGCGACGGCGGGGCTTCCCACC
TGAGGCCATCAACAACTTCTGTGCCCGG
gtatagcccagcaggttgggtagatacattgggggttgagtgtggcagtttgtgattgta
gctgtgactgatgctgaactttcctgccaggtgggagtgactgtggcacaaaccacaatg
gagccacatcttctagaagcctgtgtgcgtgatgtgctgaatgacacagccccacgagcc
EXON 18  144 bp
agggactgggatgacccacggctctttacactcacggccctgcgacggcggggcttccca
cctgaggccatcaacaacttctgtgcccgggtatagcccagcaggttgggtagatacatt
gggggttgagtgtggcagtttgtgattgtagctgtgactgatgctgaactttcctgccag
GTGGGAGTGACTGTGGCACAAACCACAATGGAGCCACATCTTCTAGAAGCCTGTGTGCGT
GATGTGCTGAATGACACAGCCCCACGAGCCATGGCTGTGCTGGAGTCACTACGGGTCATC
ATCACCAACTTTCCTGCTGCCAAG
gtgggcctgcctcaacatgtgtgtcacatgtgtgtgtgtagctgggggtacacttggctc
tgggcatgggggtcctaatgctgagtatgactcatacctgtctcctgtctcctgctatag
tccttggacatccaggtgcccaacttcccagctgatgagaccaaaggcttccatcaggtt
EXON 19  105 bp
cgagccatggctgtgctggagtcactacgggtcatcatcaccaactttcctgctgccaag
gtgggcctgcctcaacatgtgtgtcacatgtgtgtgtgtagctgggggtacacttggctc
tgggcatgggggtcctaatgctgagtatgactcatacctgtctcctgtctcctgctatag
TCCTTGGACATCCAGGTGCCCAACTTCCCAGCTGATGAGACCAAAGGCTTCCATCAGGTT
CCCTTTGCACCCATTGTCTTCATTGAGAGGACTGACTTCAAGGAG
gtaaattgtgggggtggagggtcccgtttgctgctgagtctggtactgggaacctttcat
ctcctcatctctgtcagtccatctacttcctgcttcagatgaaccaatctttgccagaca
cgggggtagggaagcttccccacttgtttgacccttgcagcctcatgtgtctaccccact
EXON 20  93 bp
ggtggagggtcccgtttgctgctgagtctggtactgggaacctttcatctcctcatctct
gtcagtccatctacttcctgcttcagatgaaccaatctttgccagacacgggggtaggga
agcttccccacttgtttgacccttgcagcctcatgtgtctaccccacttcctatctctag
GAGCCAGAGCCAGGATTTAAGCGCCTGGCTTGGGGCCAGCCTGTGGGCCTGAGGCATACA
GGCTACGTCATTGAGCTGCAGCATGTTGTCAAG
gtgagagccagctgcagccttcctactgcagtgcctgctggggccaagatgtgagtatag
cctgcagtcctggttgtggttcccgggtctaattgctgctcccctccccccacttccagg
gccccagtggttgtgtagagagtctggaggtgacctgcagacgggcagatgctggagaga
EXON 21  128 bp
gggccagcctgtgggcctgaggcatacaggctacgtcattgagctgcagcatgttgtcaa
ggtgagagccagctgcagccttcctactgcagtgcctgctggggccaagatgtgagtata
gcctgcagtcctggttgtggttcccgggtctaattgctgctcccctccccccacttccag
GGCCCCAGTGGTTGTGTAGAGAGTCTGGAGGTGACCTGCAGACGGGCAGATGCTGGAGAG
AAGCCAAAGGCCTTTATTCACTGGGTGTCACAGCCTTTGATGTGTGAGGTTCGCCTCTAT
GAGCGACT
gtgagtgaacagagctggggtgggggcaggtacaagatgcacattgcctgctatggctgc
ccagctgggggtatgaccttcactttggctgcagattccagcacaagaaccctgaagatc
ctactgaggtgcctggtggatttttaagtgacctgaacctggtaggttcatgaggtttgg
EXON 22  67 bp
cgggcagatgctggagagaagccaaaggcctttattcactgggtgtcacagcctttgatg
tgtgaggttcgcctctatgagcgactgtgagtgaacagagctggggtgggggcaggtaca
agatgcacattgcctgctatggctgcccagctgggggtatgaccttcactttggctgcag
ATTCCAGCACAAGAACCCTGAAGATCCTACTGAGGTGCCTGGTGGATTTTTAAGTGACCT
GAACCTG
gtaggttcatgaggtttggggtgagggaggtaggcctccctggttggatggttgcctgag
ttccctgcctgcaggcatcactacacgtggtggatgcagcattagtggactgctctgtgg
ccctggcaaaacccttcgacaagttccagtttgagcgtcttggatatttctccgtggatc
EXON 23  126 bp
gctgcccagctgggggtatgaccttcactttggctgcagattccagcacaagaaccctga
agatcctactgaggtgcctggtggatttttaagtgacctgaacctggtaggttcatgagg
tttggggtgagggaggtaggcctccctggttggatggttgcctgagttccctgcctgcag
GCATCACTACACGTGGTGGATGCAGCATTAGTGGACTGCTCTGTGGCCCTGGCAAAACCC
TTCGACAAGTTCCAGTTTGAGCGTCTTGGATATTTCTCCGTGGATCCAGACAGCCATCAG
GGAAAG
gtgcttgactttactcacctgccctcatctgcagcagtgacagtggctgccgttcattgt
gccaagtgctctgcatacattcccttagttaatcctcaccacctgagggagttggtattc
atattctactagtgaggaaactggcactgaggataactccaggcacaaaattttgtatga
EXON 24  147 bp
cccattcagtcccttacccaaagtcacaaagttattgaggacccgggcctcctgaccctt
agtccctcggcttctttggcttaagaaggatgttagggggaggtgtctgtggtgaaacct
gcccaggcctccctggccttgttctgggttggtggtcatccttttccctctgccctccag
CTTGTCTTTAACCGAACTGTCACACTGAAGGAAGACCCAGGAAAGGTGTGAGCTGGAAGC
ACTGAACCTACCTCATCCTCCTGGAGGGTGTGGCTACCCTCGCCACCCCAAATTCCATGT
CAATAAAGAACAGCTAAATTCTCCTAG
agtctgtgtgttatctctgcacttctagcatctgaaggccctgaagacatgctggtggtg
gtggtatgattgggggatggagatgtgccttttgcacattttgtctgtgagaatggactt
tcccagaacagagtggtactgacagctttgaaagcaccggtgcactttttggtgcttaaa